Effect of temperature and photoperiod on the growth, feed consumption, and biochemical content of juvenile green abalone, Haliotis fulgens, fed on a balanced diet

García-Esquivel, Zaúl; Montes-Magallon, S; González-Gómez, Marco A.

doi:10.1016/j.aquaculture.2006.09.022

Cited by 65 publications

(49 citation statements)

References 21 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…The incubation period of WS varies with temperature, but typically ranges from 3 to 7 mo, and mortality typically occurs from 1 to 2.5 mo after the onset of visible clinical signs (Friedman et al 1997). In addition, RLO replication and the associated disease development are enhanced at temperatures >17°C (18 to 25°C), suggesting a thermal induction of WS and its RLO (Moore et al 2000, Braid et al 2005, Garcia-Esquivel et al 2007. Metaplasia is commonly observed in WS-RLO-infected abalones held at water temperatures >18°C (Friedman et al 1997(Friedman et al , 2007 *************************************** a b PR China CGGGTGAGTAATGCTTGGAAATCTACTCAGAAGAC GenBank CGGGTGAGTAATGCTTGGAAATCTACTCAGAAGACATG Thailand CGGGTGAGTAATGCTTGGAAATCTACTCAGAAGACAT ******************************************************* sicolor supertexta to RLO infection, as compared to most of the highly susceptible cold-water species reported from California, USA , Moore et al 2001, may be another explanation for this observation.…”

Section: Discussionmentioning

confidence: 99%

See 1 more Smart Citation

Withering syndrome in the abalone Haliotis diversicolor supertexta

Wetchateng¹,

Friedman²,

Wight³

et al. 2010

Dis. Aquat. Org.

View full text Add to dashboard Cite

Abalone aquaculture is a small but growing industry in Thailand and is based on both the exotic Haliotis diversicolor supertexta and the native H. asinina. Withering syndrome (WS) in abalone is caused by an infection with the Rickettsia-like organism (RLO) 'Candidatus Xenohaliotis californiensis' and has been spread to many countries globally. The present study reports the first observation of the WS-RLO agent in the small abalone, H. diversicolor supertexta in Thailand, Taiwan (ROC) and the People's Republic of China (PRC). Under light microscopy, the RLO was observed as intracytoplasmic inclusions within epithelial cells lining the post-esophagus and, to a minor extent, the intestine of H. diversicolor. Under transmission electron microscopy, inclusions were characterized as colonies of rod-shaped bacteria, 200 × 1800 nm in size, within a vesicle in the cytoplasm of the infected cell. The RLO from the small abalone bound with WS-RLO-specific in situ hybridization probes and was amplified by polymerase chain reaction (PCR), using primers designed from the 16S rDNA sequence of the original WS-RLO from California, USA. The PCR product of RLO samples from both the PRC and Thailand showed extremely high identity with the California WS-RLO (100 and 99%, respectively). These data combined with the history of abalone movements for aquaculture purposes indicate that RLOs observed in Thailand, Taiwan and the PRC are the WS-RLO that originated from California.KEY WORDS: Haliotis diversicolor · 'Candidatus Xenohaliotis californiensis' · 16S rDNA · Abalone · Withering syndrome · Thailand · Taiwan · People's Republic of China · California Resale or republication not permitted without written consent of the publisherDis Aquat Org 90: [69][70][71][72][73][74][75][76] 2010 rickettsial agent of withering syndrome (WS) are present in abalone under culture. Prior to the present study, the infection of Asian abalone species by Rickettsia-like organisms (RLOs) had not been observed or described; however, such knowledge is needed for the successful development and expansion of abalone aquaculture in Asia.WS is a catastrophic disease, caused by the intracellular RLO 'Candidatus Xenohaliotis californiensis . WS affects a variety of abalone species and was first observed in populations of wild black abalone Haliotis cracherodii in the mid-1980s (Haaker et al. 1992). Affected black abalone had an atrophied foot muscle and high mortality rates, especially in populations off southern California, USA (Haaker et al. 1992). The disease progressively spread throughout southern and central California (Haaker et al. 1992, Altstatt et al. 1996, Friedman & Finley 2003, Miner et al. 2006. By 1992, WS was associated with population declines on 6 of the 8 Channel Islands, with losses of up to 99% of H. cracherodii (VanBlaricom et al. 1993, Tissot 1995. These losses led, in part, to an initial closure of the California black abalone fishery in 1993, followed by total closure in 1997 (Haaker et al. 2001). Losses due to WS vary among host ...

show abstract

Section: Discussionmentioning

confidence: 99%

“…However, green abalone only showed signs of WS when held at elevated temperatures, e.g. 25°C (Garcia-Esquivel et al 2007), but not when held at 18°C, a temperature at which black and red abalones typically succumb to WS , Moore et al 2009). …”

mentioning

confidence: 99%

Withering syndrome in the abalone Haliotis diversicolor supertexta

Wetchateng¹,

Friedman²,

Wight³

et al. 2010

Dis. Aquat. Org.

View full text Add to dashboard Cite

show abstract

“…Los estudios realizados con juveniles y adultos de diferentes especies de abulón han demostrado que la tasa de alimentación puede ser de 0.9% a 24.1% mayor en cultivos en la oscuridad con respecto a cultivos en la luz. La tasa de crecimiento también puede alcanzar valores entre 16% y 259% mayores en la oscuridad (Kim et al 1997, Huchette 2003, García-Esquivel et al 2007. Se desconoce si las postlarvas de abulón tienen hábitos nocturnos similares a los abulones juveniles y adultos; sin embargo, a nivel Effect of darkness on the early postlarval development of Haliotis corrugata abalone fed different diatom densities…”

Section: Introductionunclassified

“…Research conducted on juveniles and adults of different species of abalone has shown that in a dark environment the feeding rate can be from 0.9% to 24.1% higher and the growth rate from 16% to 259% higher than under light conditions (Kim et al 1997, Huchette 2003, García-Esquivel et al 2007). Whether postlarval abalone have similar nocturnal habits as those of juvenile and adult abalone is not known; however, experiments have shown that the grazing rate of 6-day-old Haliotis rufescens postlarvae is 37%…”

Section: Introductionmentioning

confidence: 99%

Effect of darkness on the early postlarval development of Haliotis corrugata abalone fed different diatom densities

Gorrostieta-Hurtado¹,

Searcy-Bernal²,

Anguiano-Beltrán³

et al. 2009

Cienc. Mar.

View full text Add to dashboard Cite

Four-day-old postlarvae of the abalone Haliotis corrugata were exposed to different diatom densities (Navicula incerta, 0 to 8000 cells mm–2) under two illumination conditions: constant light (19–21 µmol quanta m–2 s–1) and darkness. The effect of these two factors on postlarval grazing rate, survival, and growth was evaluated. The experiment was conducted for 14 days in 10-mL sterile wells following a split-plot experimental design with three replicates per treatment. The highest grazing rate was observed in the 2000 cells mm–2 density treatment and it was higher in darkness (196 ± 67 cells pl–1 h–1) than in constant light (139 ± 36 cells pl–1 h–1). Mean survival was also higher in darkness (59%) than under constant light (44%), as was mean growth rate (20 and 14 µm d–1, respectively). Growth rate at the end of the experimental period tended to decrease with the increase in diatom density. Higher grazing and growth rates in darkness reinforce the hypothesis that the nocturnal habits of abalone develop soon after metamorphosis and not at juvenile stages as usually considered.

show abstract

“…For this purpose, LC 50 96 h of each ecotoxicology studies is required. Temperature is one of the limitation factors for fish growth, which is affecting the metabolic rate and growth control physiologic mechanisms [15,16]. Changes in the physical properties of contaminants including pesticides, affecting detoxification rate and biochemical processes of the exposed animals to contaminant are the effects of temperature in the aquatic ecosystems that play a crucial role of life availability and contaminant toxicity [17,18].…”

mentioning

confidence: 99%