Effects of caudal hindbrain lactate infusion on insulin‐induced hypoglycemia and neuronal substrate transporter glucokinase and sulfonylurea receptor‐1 gene expression in the ovariectomized female rat dorsal vagal complex: Impact of estradiol

Abstract

The monocarboxylate, lactate, is produced by astrocytic glycolysis and is trafficked to neurons as a substrate fuel for aerobic respiration. This molecule is a critical monitored metabolic variable in hindbrain detection of cellular energy imbalance, because diminished uptake and/or oxidative catabolism of lactate in this part of the brain activates neural mechanisms that increase systemic glucose availability. Lactate-sensitive chemosensory neurons occur in the hindbrain dorsal vagal complex (DVC). Estradiol (E) enhances expression of the neuronal monocarboxylate transporter MCT2 in the DVC during insulin-induced hypoglycemia (IIH), evidence that this hormone may promote local lactate utilization during systemic glucose shortages. We investigated the hypothesis that E regulates basal and IIH-associated patterns of DVC MCT2 and neuronal glucose transporter gene expression and that caudal fourth ventricular (CV4) lactate infusion exerts divergent effects on blood glucose levels and DVC energy transducer gene profiles in hypoglycemic E- vs. oil (O)-implanted ovariectomized (OVX) rats. Insulin-induced decrements in circulating glucose were significantly augmented by lactate, albeit to a greater extent in the presence of E. DVC MCT2, GLUT3, GLUT4, glucokinase (GCK), and sulfonylurea receptor-1 (SUR1) mRNA levels did not differ between saline-injected OVX + E and OVX + O rats. IIH elevated MCT2 and GLUT3 gene profiles in both E- and O-implanted groups, but up-regulation of MCT2 transcripts was reversed by CV4 lactate infusion during hypoglycemia in E- but not O-implanted animals. DVC GLUT4 and GK mRNA were decreased by insulin alone in OVX + O but not OVX + E, but were suppressed by lactate plus insulin treatment in the latter group. Expression of the SUR1 subunit of the energy-dependent potassium channel K(ATP) was significantly decreased by IIH in both E- and O-treated rats and further suppressed in response to lactate delivery during hypoglycemia in OVX + E. These data reveal that E does not control baseline DVC substrate fuel transporter or energy transducer gene profiles or local MCT2, GLUT3, or SUR1 transcriptional responses to IIH but prevents IIH-associated decreases in GLUT4 and GCK mRNA in this brain site. The results also show that, in the presence of E, intensifying effects of CV4 lactate infusion on hypoglycemia are correlated with reversal of IIH enhancement of DVC MCT2 gene expression, augmented IIH inhibition of SUR1 transcripts, and reductions in GLUT4 and GCK mRNA levels relative to baseline. This work implies that IIH may enhance specific neuronal lactate and glucose transport mechanisms in the female rat DVC and that, in the presence of E, caudal hindbrain lactate repletion may normalize neuronal lactate but not glucose internalization by local neurons. The results also suggest that putative IIH-associated reductions in K(ATP)-mediated regulation of membrane voltage in this brain site may be causally related to diminished glucose availability.

Monocarboxylate transporters: new players in body weight regulation

“…Finally, lactate infusion in this brain area reversed the insulin-induced hypoglycaemia-mediated reduction of MCT2 expression and increase of GLUT3 expression (45). Such results have been observed in both hypothalamus and dorsal vagal complex, two regions implicated in glucose and energy homeostasis regulation (46)(47)(48). Furthermore, inhibition of MCTs in these specific brain metabolic-sensitive regions is associated with a defect of energy deficiency counter-regulatory responses (49,50).…”

Effects of hypoglycaemia on neuronal metabolism in the adult brain: role of alternative substrates to glucose

“…Furthermore, the use of these monocarboxylates might contribute to reduce the risk of hypoglycaemia-induced brain injury in intensively treated diabetic patients. Interestingly, insulin-induced hypoglycaemia was shown to up-regulate neuronal monocarboxylate transporter MCT2 and glucose transporter GLUT-3 through an estrogen-mediated mechanism in lactate-sensitive chemosensory neurons (Vavaiya et al 2006;Vavaiya and Briski 2008b, a). These studies provided further evidence on the existence of mechanisms to enhance lactate and glucose transport mechanisms and promote local lactate utilization during hypoglycaemia in neurons.…”

Estradiol regulates effects of hindbrain activator 5-aminoimidazole-4-carboxamide-riboside administration on hypothalamic adenosine 5′-monophosphate-activated protein kinase activity and metabolic neurotransmitter mRNA and protein expression

“…Forward and reverse primers for target genes were designed in Beacon Designer‐5 software (Premier Biosoft International, Palo Alto, CA) and were purchased from Genemed Synthesis (San Antonio, TX): CRH, forward 5‐CAGCCGTTGAATTTCTTG‐3, reverse 5‐GACTTCT‐GTTGAGGTTCC‐3; POMC, forward 5‐TCACCACGGAAAGCAACCTG‐3, reverse 5‐TTTCAGT‐CAAAGGCTGTTC‐ATCTC‐3; NPY, forward 5‐ATGCTAGGTAACAAACG‐3, reverse 5‐ATGTA‐GTGTCGCAGAG‐3; SF‐1, forward 5‐ GTACGGCAAGGAAGACAGCATC‐3, reverse 5‐TTCAC‐ATCGAGGCTGAAGA‐GGA‐3. PCRs with Sybr Green‐based detection were performed as described elsewhere (Vavaiya and Briski, ; Vavaiya et al, ) in a Bio‐Rad (Hercules, CA) i Q 5 iCycler system with an initial 3 min of denaturation at 95°C, followed by 40 1‐min cycles of 30 sec at 95°C, followed by 30 sec at 58°C for CRH; 30 sec at 57°C for POMC; 30 sec at 51°C for NPY; or 30 sec at 58.7°C for SF‐1. Glyceraldehyde‐3‐phosphate dehydrogenase (forward 5‐ACAGCCGCA TCTT‐CTTGTGC‐3, reverse 5‐GCCTCACCCCAT TTGATGTT‐3) gene expression was measured as a housekeeping control.…”