Effects of Different Additives on Fermentation Quality, Microbial Communities, and Rumen Degradation of Alfalfa Silage

Ling, Wenqing; Zhang, Lei; Feng, Qixian; Degen, A. Allan; Li, Jue; Qi, Yue; Li, Yan; Zhou, Yi; Liu, Yijia; Yang, Fulin; Zhou, Jing

doi:10.3390/fermentation8110660

Cited by 7 publications

(4 citation statements)

References 57 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The DM ruminal degradation rate is positively associated with the feed intake of dairy cows [5]. Recent research found that alfalfa silage inoculated with lactic acid bacteria increased DM ruminal degradation [43]. Consistent with this previous study, our results showed that the DM degradability at 72 h and the effective degradability in the rumen of the LBC group were highest, which might have been associated with the elevated DM content in the LBC mixed silage.…”

Section: Discussionsupporting

confidence: 91%

Lactic Acid Bacteria and Cellulase Improve the Fermentation Characteristics, Aerobic Stability and Rumen Degradation of Mixed Silage Prepared with Amaranth and Rice Straw

Ma,

Fan,

et al. 2023

Fermentation

View full text Add to dashboard Cite

The aim of this experiment is to investigate the effects of lactic acid bacteria and cellulase on the fermentation quality, chemical composition, aerobic stability and ruminal degradation characteristics of mixed silage prepared with amaranth and rice straw. Lactic acid bacteria and cellulase were used as silage additives, and the four treatments were as follows: control group (CON, no additive), lactic acid bacteria group (LAB, additive amount was 5 mg/kg fresh matter), cellulase group (CEL, 2 mg/kg) and lactic acid bacteria and cellulase group (LBC, additive amount was the same as in the individual treatments). All treatments were ensiled for 60 days. The dry-matter, crude-protein, neutral-detergent-fiber and acid-detergent-fiber ruminal degradability of silage were analyzed utilizing the nylon bag method. Compared with the CON group, the inoculation of lactic acid bacteria and cellulase individually promoted the fermentation of mixed silage to a certain degree. The combined inoculation of mixed silage significantly increased (p < 0.05) the concentrations of lactic acid and dry matter, while it reduced (p < 0.05) the pH and ammonia nitrogen/total nitrogen, harmful microorganism counts and contents of acetic acid, neutral detergent fiber and acid detergent fiber. In addition, the aerobic stability time of the LBC group was lower (p < 0.05) than that of the other groups. The ruminal degradation rate of dry matter, crude protein, neutral detergent fiber and acid detergent fiber in the LBC group was significantly increased (p < 0.05) compared to the CON group. Overall, the addition of the additives mentioned earlier improved the quality of mixed silage composed of amaranth and rice straw, and the best results were obtained by combining the inoculation of lactic acid bacteria and cellulase.

show abstract

Section: Discussionsupporting

confidence: 91%

Lactic Acid Bacteria and Cellulase Improve the Fermentation Characteristics, Aerobic Stability and Rumen Degradation of Mixed Silage Prepared with Amaranth and Rice Straw

Ma,

Fan,

et al. 2023

Fermentation

View full text Add to dashboard Cite

show abstract

“…The increase ( p < 0.05) of CP content with the LB treatment most likely involved propionic acid. L. buchneri produces 1,2-propanediol from sugars and then propionic acid in the metabolic process, resulting in a bacteriostatic effect ( Ling et al, 2022 ).…”

Section: Resultsmentioning

confidence: 99%

“…High throughput sequencing was performed in triplicate, and total DNA was extracted using the CTAB/SDS method to check DNA concentration and purity with a 1% agarose gel. The 16S rDNA gene of the bacterial V3 ~ V4 hypervariable region was obtained by primer sequences 338F (ACTCCTACGGGAGGCAGCAG) and 806R (GGACTAC HVGGGTWTCTAAT) ( Ling et al, 2022 ). PCR amplicons were identified by agarose gel electrophoresis using NEXTFLEX ® Rapid DNA-Seq Kit for Miseq library construction and sequencing.…”

Section: Methodsmentioning

confidence: 99%

Ensiling hybrid Pennisetum with lactic acid bacteria or organic acids improved the fermentation quality and bacterial community

et al. 2023

Self Cite

View full text Add to dashboard Cite

The aim of this study was to compare the effect of different additives on nutritional quality, fermentation variables and microbial diversity of hybrid Pennisetum silages. A control (CK – no additives) and seven treatments were tested, namely, Lactiplantibacillus plantarum (LP), Lentilactobacillus buchneri (LB), propionic acid (PA), calcium propionate (CAP), LP + LB; LP + PA and LP + CAP. In comparison with CK, all treatments increased the contents of crude protein and lactic acid, decreased the content of butyric acid, and altered the bacterial communities of the silage. Except for the CAP and LP + CAP treatments, the additives decreased pH and the ammonia nitrogen:total nitrogen (NH3-N:TN) ratio. The results of principal component analysis revealed that the PA, LP + PA and LP + LB treatments ranked as the top three silages. The PA and LP + PA treatments exhibited higher water-soluble carbohydrate content, but lower pH, and NH3-N:TN ratio than the other treatments. With the PA and LP + PA treatments, the relative abundances of Lactobacillus and Enterobacter decreased, and of Proteobacteria and Delftia increased, while the carbohydrate metabolism of the microorganisms improved. The LP and LB treatments reduced the Shannon and Simpson diversities. In the beta diversity, PA and LP + PA separated from the other treatments, indicating that there were differences in the composition of bacterial species. The relative abundance of Lactobacillus increased in the LP and LB treatments and of Leucanostoc and Weissella increased in the CAP and LP + CAP treatments. In summary, the addition of L. plantarum, L. buchneri, propionic acid, calcium propionate, and their combinations improved fermentation quality, inhibited harmful bacteria and conserved the nutrients of hybrid Pennisetum.

show abstract

“…The nylon bag method [ 19 , 20 ] was used to analyze the rumen degradation characteristics of DM, CP, NDF and ADF in two samples. The size of the nylon bags was 80 mm × 130 mm, and the aperture was 300 mesh.…”

Section: Methodsmentioning

confidence: 99%

Analysis of Rumen Degradation Characteristics, Attached Microbial Community, and Cellulase Activity Changes of Garlic Skin and Artemisia argyi Stalk

Gu,

Liu,

Jiang

et al. 2024

Animals

View full text Add to dashboard Cite

The purpose of this study was to study the chemical composition, rumen degradation characteristics, surface attached microbial community and cellulase activity of garlic skin (GS) and Artemisia argyi stalk (AS), in order to explain their feeding value. Four 14-month-old healthy Min Dong male goats with permanent rumen fistula were selected as experimental animals. The rumen degradation characteristics of GS and AS were determined by using the nylon bag method, and the bacterial composition, cellulase activity and their relationship on the surface of the two groups were analyzed with high-throughput sequencing of 16S rRNA gene. The results showed that in GS and AS, the effective degradation rate (ED) values of dry matter (DM) were 42.53% and 37.12%, the ED values of crude protein (CP) were 37.19% and 43.38%, the ED values of neutral detergent fiber (NDF) were 36.83% and 36.23%, and the ED values of acid detergent fiber (ADF) were 33.81% and 34.77%. During rumen degradation, the richness and evenness of bacteria attached to the AS surface were higher. At the phylum level, Bacteroidetes and Firmicutes were always the main rumen bacteria in the two groups. At the genus level, fiber-degrading bacteria such as Prevotella, Treponema, and Ruminococcus showed higher levels in GS (p < 0.05). Compared with GS, the activity of β-glucosidase (BG enzyme), endo-β-1,4-glucanase (C1 enzyme), exo-β-1,4-glucanase (Cx enzyme) and neutral xylanase (NEX enzyme) attached to AS surface showed a higher trend. Correlation analysis showed that the relative abundance of Succinivibrio and Rikenellaceae_RC9_gut_group was positively correlated with the rumen degradability of nutrients in GS, and the relative abundance of Christensenellaceae R-7_group, Succinivibrio and Ruminococcus was positively correlated with the rumen degradability of nutrients in AS. The conclusion of this study shows that AS has more potential to become ruminant roughage than GS. In addition, this study also revealed the relationship between cellulase activity and bacteria, which provided new information for us to better analyze the effects of GS and AS on the rumen of ruminants and provided an important theoretical basis for the development and utilization of agricultural by-products.

show abstract

Effects of Different Additives on Fermentation Quality, Microbial Communities, and Rumen Degradation of Alfalfa Silage

Cited by 7 publications

References 57 publications

Lactic Acid Bacteria and Cellulase Improve the Fermentation Characteristics, Aerobic Stability and Rumen Degradation of Mixed Silage Prepared with Amaranth and Rice Straw

Lactic Acid Bacteria and Cellulase Improve the Fermentation Characteristics, Aerobic Stability and Rumen Degradation of Mixed Silage Prepared with Amaranth and Rice Straw

Ensiling hybrid Pennisetum with lactic acid bacteria or organic acids improved the fermentation quality and bacterial community

Analysis of Rumen Degradation Characteristics, Attached Microbial Community, and Cellulase Activity Changes of Garlic Skin and Artemisia argyi Stalk

Contact Info

Product

Resources

About