Effects of Histone Deacetylase Inhibitors on the Ah Receptor Gene Promoter

Garrison, Patricia M.; Rogers, Jane M.; Brackney, William R.; Denison, Michael S.

doi:10.1006/abbi.1999.1620

Cited by 46 publications

(27 citation statements)

References 48 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…22,23 Accordingly, inhibitors of histone deacetylation and DNA methylation triggered expression of this gene in AhR-negative cell lines. Thus, results with the U-2932 subclones and other DLBCL cell lines indicate that AhR-regulated high expression of wild-type MEF2B might be an additional, independent cause of the aberrant expression of BCL6 in DLBCL besides canonical BCL6 translocations, BCL6 hypermutation and MEF2B mutations.…”

Section: Discussionmentioning

confidence: 99%

“…22,23 To test whether AhR expression differences in DLBCL cell lines were subject to epigenetic regulation we treated AhR-positive (SU-DHL6, U-2932 R1) and AhR-negative (OCI-LY19, U-2932 R2) cell lines with inhibitors of histone deacetylation and DNA methylation. Both types of inhibitor significantly induced AhR expression in the negative cell lines, suggesting that differences at the epigenetic level were responsible for the expression of AhR in DLBCL cell lines (Table 1).…”

Section: Ahr/arnt Activity Driving Gene Expression In U-2932 Subclone R1mentioning

confidence: 99%

See 1 more Smart Citation

BCL6 - regulated by AhR/ARNT and wild-type MEF2B - drives expression of germinal center markers MYBL1 and LMO2

et al. 2015

View full text Add to dashboard Cite

Knock-down experimentsTransfection with short interfering (si) RNA oligonucleotides was performed as described elsewhere.14 Gene-specific siRNA oligonucleotides and AllStars negative control siRNA were obtained from Qiagen (Hilden, Germany). The siRNA (80 pmol) were transfected into 1x10 6 cells by electroporation using an EPI-2500 impulse generator (Fischer, Heidelberg, Germany) at 350 V for 10 ms. Treated cells were harvested after 20 h.

show abstract

Section: Discussionmentioning

confidence: 99%

Section: Ahr/arnt Activity Driving Gene Expression In U-2932 Subclone R1mentioning

confidence: 99%

BCL6 - regulated by AhR/ARNT and wild-type MEF2B - drives expression of germinal center markers MYBL1 and LMO2

et al. 2015

View full text Add to dashboard Cite

show abstract

“…Specifically, DNA hypermethylation [7] and histone deacetylation [8] have been shown to down-regulate AhR expression, whereas activation of transcription factor specificity protein-1 (Sp1) increases AhR transcription [9]. Sp transcription factors form a family of four C 2 H 2 zinc-finger DNA binding proteins (Sp1-4) that regulate basal and inducible transcription of many genes via binding to GC boxes (GGGCGG), GT motifs (GGGTGTGGC), or CT elements (CCTCCTCCTCCTCGGCCTCCTCCCC) in the promoter region of target genes [10].…”

Section: Introductionmentioning

confidence: 99%

Overexpression of antioxidant enzymes upregulates aryl hydrocarbon receptor expression via increased Sp1 DNA-binding activity

Tang

Lin

Hong

et al. 2010

Free Radical Biology and Medicine

View full text Add to dashboard Cite

We previously reported up-regulation of aryl hydrocarbon receptor (AhR) expression as a mechanism by which overexpression of Cu/Zn-superoxide dismutase (SOD) and/or catalase accelerates benzo(a)pyrene (BaP) detoxification in mouse aorta endothelial cells (MAECs). The objective of this study was to investigate the regulatory role of specificity protein-1 (Sp1) in AhR expression in MAECs that overexpress Cu/Zn-SOD and/or catalase. Our data demonstrated comparable levels of nuclear Sp1 protein in the transgenic and wild-type MAECs; however, binding of Sp1 protein to the AhR promoter region was more than 2-fold higher in MAECs overexpressing Cu/Zn-SOD and/or catalase than in wild-type cells. Inhibition of Sp1 binding to the AhR promoter by mithramycin A reduced AhR expression and eliminated the differences between wild-type MAECs, and three lines of transgenic cells. Functional promoter analysis indicated that AhR promoter activity was significantly higher in MAECs overexpressing catalase than in wild-type cells. Mutation of an AhR promoter Sp1-binding site or addition of hydrogen peroxide to the culture medium reduced AhR promoter activity, and decreased the differences between wild-type MAECs and transgenic cells overexpressing catalase. These results suggest that increased Sp1 binding to the AhR promoter region is an underlying mechanism for up-regulation of AhR expression in MAECs that overexpress Cu/Zn-SOD and/or catalase.

show abstract

“…In addition, an inhibitor of DNA methyltransferases and other HDACi, 5-azacytidine and sodium butyrate, were shown to reactivate a functional Ah receptor in the differentiated hepatoma cell line Fao, indicating that a requisite gene had been silenced by an epigenetic mechanism (Gudas and Hankinson 1987). Furthermore, Garrison et al (2000) reported that both n-butyrate and TSA increased the constitutive activity of the murine AhR gene promoter in cell lines and was correlated with an increase in endogenous AhR activity in an AhR-deficient cell line. In this study, the expression of p21, C/EBPa, CYP1A1, and CYP1B1 in HCAs was decreased as compared with the surrounding hepatocytes at mRNA or protein levels accompanied by apparent accumulation of HDAC1 in the nuclei of HCAs, indicating that an epigenetic mechanism might be responsible for the regulation of their expression in HCAs.…”

Section: Discussionmentioning

confidence: 99%

Molecular Expression Analysis of β-Naphthoflavone-induced Hepatocellular Tumors in Rats

et al. 2009

View full text Add to dashboard Cite

The present study was performed to characterize molecular expression levels of preneoplastic and neoplastic lesions induced by b-naphthoflavone (BNF), an aryl hydrocarbon receptor (AhR) agonist in rat hepatocarcinogenesis. Male F344 rats were initiated with an intraperitoneal injection of 200 mg/kg N-diethylnitrosamine, and two weeks later, they were fed a diet containing 0% or 1% BNF for twenty-eight weeks. All animals were subjected to a two-thirds partial hepatectomy at week 3 and sacrificed at week 30. Histopathologically, BNF increased the incidence and multiplicity of altered foci (1.7-fold and 3.3-fold) and hepatocellular adenomas (HCAs) (4.0-fold and 4.7-fold). Immunohistochemically, BNF increased the number of proliferating cell nuclear antigen (PCNA)-positive cells in altered foci (2.3-fold) and HCAs (6.7-fold) compared with the surrounding tissue and decreased the staining of cell cycle regulators (P21, C/EBPa). In addition, loss of reactivity for AhR-regulated (CYP1A1, CYP1B1) molecules and increased reactivity of Nrf-2-regulated (AKR7, GPX2) molecules were also observed in proliferative lesions. Furthermore, increased staining of histone deacetylase (HDAC1) in the nucleus was prominent in HCAs. The differential expression patterns were confirmed at mRNA levels by realtime reverse transcription-polymerase chain reaction (RT-PCR) analysis. These results suggest that enhanced cell proliferation and protection against oxidative stress play an important role in BNF-induced hepatocarcinogenesis in rats.

show abstract

Effects of Histone Deacetylase Inhibitors on the Ah Receptor Gene Promoter

Cited by 46 publications

References 48 publications

BCL6 - regulated by AhR/ARNT and wild-type MEF2B - drives expression of germinal center markers MYBL1 and LMO2

BCL6 - regulated by AhR/ARNT and wild-type MEF2B - drives expression of germinal center markers MYBL1 and LMO2

Overexpression of antioxidant enzymes upregulates aryl hydrocarbon receptor expression via increased Sp1 DNA-binding activity

Molecular Expression Analysis of β-Naphthoflavone-induced Hepatocellular Tumors in Rats

Contact Info

Product

Resources

About