Efficient CRISPR/Cas9‐Mediated Mutagenesis in Primary Murine T Lymphocytes

Huang, Bruce; Johansen, Kjell; Schwartzberg, Pamela L.

doi:10.1002/cpim.62

Cited by 15 publications

(25 citation statements)

References 74 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…In particular, we focused on cCbl and PI3K, both of which show defective activation in Crk-deficient T cells. To target these proteins, we implemented a CRISPR KO system in primary mouse T cells (33). T cell blasts cultured from Cas9-expressing mice were transduced with retroviral vectors containing non-targeting (NT), cCbl, or PI3Kδ gRNAs.…”

Section: Resultsmentioning

confidence: 99%

“…The recently described gRNA retroviral transfer vector MRIG (33) was modified to express the puromycin resistance gene in place of GFP. Specific gRNAs were cloned into this vector exactly as described in (33). The gRNA sequences used in this study were as follows, NT: 5' GCGAGGTATTCGGCTCCGCG, cCbl: 5' TGTCCCTTCTAGCCGCCCAG, and PI3Kδ: 5' GGAGCGTGGGCGCATCACGG.…”

Section: Retroviral Productionmentioning

confidence: 99%

See 1 more Smart Citation

LFA-1 signals to promote actin polymerization and upstream migration in T cells

Roy

Kim

Buffone

et al. 2020

Preprint

Self Cite

View full text Add to dashboard Cite

Statement:Inflammatory responses require leukocyte migration along the vascular wall. We show that signaling from β2, but not β1, integrins induces cytoskeletal changes needed for upstream migration under shear flow. AbstractT cell entry into inflamed tissue requires firm adhesion, cell spreading, and migration along and through the endothelial wall. These events require the T cell integrins LFA-1 and VLA-4 and their endothelial ligands ICAM-1 and VCAM-1, respectively. T cells migrate against the direction of shear flow on ICAM-1 and with the direction of shear flow on VCAM-1, suggesting that these two ligands trigger distinct cellular responses. However, the contribution of specific signaling events downstream of LFA-1 and VLA-4 has not been explored. Using primary mouse T cells, we found that engagement of LFA-1, but not VLA-4, induces cell shape changes associated with rapid 2D migration. Moreover, LFA-1 ligation results in activation of the PI3K and ERK pathways, and phosphorylation of multiple kinases and adaptor proteins, while VLA-4 ligation triggers only a subset of these signaling events.Importantly, T cells lacking Crk adaptor proteins, key LFA-1 signaling intermediates, or the ubiquitin ligase cCbl, failed to migrate against the direction of shear flow on ICAM-1. These studies identify novel signaling differences downstream of LFA-1 and VLA-4 that drive T cell migratory behavior.Migration of leukocytes from the vasculature into peripheral tissue is central to their role in fighting pathogens, promoting tissue repair, and attacking solid tumors. This process, called transendothelial migration (TEM), is a key control point in the inflammatory response (1). TEM is a multi-step process that begins with selectin-dependent cell rolling on the vasculature, followed by chemokine-induced cell arrest. At this point, integrins expressed on the leukocyte interact with their endothelial ligands, resulting in shear resistant adhesion, cell spreading, and migration along the endothelium (1-3). Leukocyte migration along the vascular wall is a prerequisite for transmigration, and is thought to allow cells to search for ideal sites such as 3-way junctions to cross the endothelial layer (4-8). Intravital imaging of immune responses in vivo has revealed that leukocyte migration along the endothelial monolayer is not random and can be directed by shear flow forces (9, 10). Interestingly, leukocytes have been observed to preferentially migrate against the direction of shear flow (10), an unexpected result given the extra energy expenditure needed to oppose head-on shear forces. Although it is not clear why leukocytes display this phenotype, in vitro studies have shown that T cells crawling against the direction of shear on inflamed endothelia are more likely to undergo transmigration (11, 12), suggesting a link between these two mechanically demanding processes. T cell adhesion and migration on the vascular wall are dependent on integrin interactions with their endothelial ligands. The two major integrin ligands expressed o...

show abstract

Section: Resultsmentioning

confidence: 99%

Section: Retroviral Productionmentioning

confidence: 99%

LFA-1 signals to promote actin polymerization and upstream migration in T cells

Roy

Kim

Buffone

et al. 2020

Preprint

Self Cite

View full text Add to dashboard Cite

show abstract

“…Researchers have created Cas9 transgenic mice ( 8 , 10 ). To manipulate their T cells, however, gRNAs are still introduced per retroviral transduction ( 7 , 8 ). Apart from the fact that this is more tedious and time consuming than electroporation, retroviral backbones could cause immunogenicity and toxicity ( 33 ).…”

Section: Discussionmentioning

confidence: 99%

“…With this, they are even able to transduce non-activated T cells with high efficiency ( 3 ). Alternatively, pre-stimulated T cells from Cas9 transgenic mice can be mutated by guide (g) RNAs, the combination of crRNA and tracrRNA, which are delivered via retroviral transduction ( 7 , 8 ). Since studies have shown that at least sole mRNA can be successfully electroporated into T cells ( 9 ), we attempted to make use of Cas9 transgenic mice ( 10 ) and to develop efficient gRNA-only delivery into naive T cells using a nucleofection technique.…”

Section: Introductionmentioning

confidence: 99%

Rapid and Efficient Gene Editing for Direct Transplantation of Naive Murine Cas9+ T Cells

et al. 2021

View full text Add to dashboard Cite

Gene editing of primary T cells is a difficult task. However, it is important for research and especially for clinical T-cell transfers. CRISPR/Cas9 is the most powerful gene-editing technique. It has to be applied to cells by either retroviral transduction or electroporation of ribonucleoprotein complexes. Only the latter is possible with resting T cells. Here, we make use of Cas9 transgenic mice and demonstrate nucleofection of pre-stimulated and, importantly, of naive CD3+ T cells with guideRNA only. This proved to be rapid and efficient with no need of further selection. In the mixture of Cas9+CD3+ T cells, CD4+ and CD8+ conventional as well as regulatory T cells were targeted concurrently. IL-7 supported survival and naivety in vitro, but T cells were also transplantable immediately after nucleofection and elicited their function like unprocessed T cells. Accordingly, metabolic reprogramming reached normal levels within days. In a major mismatch model of GvHD, not only ablation of NFATc1 and/or NFATc2, but also of the NFAT-target gene IRF4 in naïve primary murine Cas9+CD3+ T cells by gRNA-only nucleofection ameliorated GvHD. However, pre-activated murine T cells could not achieve long-term protection from GvHD upon single NFATc1 or NFATc2 knockout. This emphasizes the necessity of gene-editing and transferring unstimulated human T cells during allogenic hematopoietic stem cell transplantation.

show abstract

“…Alternatively, the sgRNA is introduced by γ-retroviral transduction into Cas9 transgenic mice expressing the Cas9 enzyme endogenously in T cells. γ-Retroviruses efficiently infect activated proliferating mouse T cells (Zhang et al , 2003 ; Kerkar et al , 2011 ), and this approach has been shown to effectively target mouse T cell genes (Huang et al , 2019 ; Roy et al , 2020 ). Retroviral delivery of sgRNAs has the important added benefit that retroviruses are integrated into the genome, and hence can be identified by next-generation sequencing allowing for pooled CRISPR/Cas9-mediated screening.…”

Section: Crispr/cas9-mediated Gene Ko In T Cellsmentioning

confidence: 99%

How CRISPR/Cas9 Gene Editing Is Revolutionizing T Cell Research

Johansen

2022

DNA and Cell Biology

Self Cite

View full text Add to dashboard Cite

Clustered regularly interspaced short palindromic repeats (CRISPR)/Cas9 allows for precise gene targeting in mammalian cells, including T cells, allowing scientists to disrupt or edit specific genes of interest. This has enabled immunologists to investigate T cell functions as well as opened the path for novel therapeutics involving gene editing of T cells ex vivo before transferring these back to patients to increase T cell efficacy. This review outlines how CRISPR/Cas9 has transformed T cell research allowing immunologists to rapidly probe the roles of genes in T cells thus paving the way for novel therapeutics. Furthermore, this review describes how these tools reduce the requirement for genetic mouse models, while increasing the translational potential of T cell research.

show abstract

Efficient CRISPR/Cas9‐Mediated Mutagenesis in Primary Murine T Lymphocytes

Cited by 15 publications

References 74 publications

LFA-1 signals to promote actin polymerization and upstream migration in T cells

LFA-1 signals to promote actin polymerization and upstream migration in T cells

Rapid and Efficient Gene Editing for Direct Transplantation of Naive Murine Cas9+ T Cells

How CRISPR/Cas9 Gene Editing Is Revolutionizing T Cell Research

Contact Info

Product

Resources

About