Efg1-mediated Recruitment of NuA4 to Promoters Is Required for Hypha-specific Swi/Snf Binding and Activation inCandida albicans

Abstract

Efg1 is essential for hyphal development and virulence in the human pathogenic fungus Candida albicans. How Efg1 regulates gene expression is unknown. Here, we show that Efg1 interacts with components of the nucleosome acetyltransferase of H4 (NuA4) histone acetyltransferase (HAT) complex in both yeast and hyphal cells. Deleting YNG2, a subunit of the NuA4 HAT module, results in a significant decrease in the acetylation level of nucleosomal H4 and a profound defect in hyphal development, as well as a defect in the expression of hypha-specific genes. Using chromatin immunoprecipitation, Efg1 and the NuA4 complex are found at the UAS regions of hypha-specific genes in both yeast and hyphal cells, and Efg1 is required for the recruitment of NuA4. Nucleosomal H4 acetylation at the promoters peaks during initial hyphal induction in an Efg1-dependent manner. We also find that Efg1 bound to the promoters of hypha-specific genes is critical for recruitment of the Swi/Snf chromatin remodeling complex during hyphal induction. Our data show that the recruitment of the NuA4 complex by Efg1 to the promoters of hypha-specific genes is required for nucleosomal H4 acetylation at the promoters during hyphal induction and for subsequent binding of Swi/Snf and transcriptional activation. INTRODUCTIONCandida albicans has emerged as one of the most prevalent opportunistic fungal pathogens in humans. It causes mucosal as well as systemic candidiasis, especially in immunocompromised patients. C. albicans can undergo reversible morphogenetic transitions between budding yeast, pseudohyphal, and hyphal growth forms. Its unique ability to switch from yeast to hyphal growth in response to various signals is essential for its pathogenicity.Central to the yeast-to-hypha transition is the transcription factor Efg1, a member of the Asm1p, Phd1p, Sok2p, Efg1p, and StuAp (APSES) family of fungal proteins that regulate cellular differentiation in ascomycetes. Members of this family share a conserved DNA binding domain. Efg1 is an essential regulator of hyphal development, chlamydospore formation, and white-opaque phenotypic switching in C. albicans (Lo et al., 1997;Stoldt et al., 1997;Sonneborn et al., 1999;Srikantha et al., 2000;Zordan et al., 2007). It is suggested to function downstream of the cAMP/protein kinase A (PKA) pathway in hyphal development (Sonneborn et al., 2000;Bockmuhl and Ernst, 2001), and both Efg1 and PKA are required for the induction of hypha-specific genes. However, Efg1 also regulates other genes that are not modulated by the cAMP pathway (Sohn et al., 2003;Doedt et al., 2004;Harcus et al., 2004;Setiadi et al., 2006). Numerous in vitro and in vivo studies with efg1 mutants have demonstrated that Efg1 is important for C. albicans virulence and for the interactions of C. albicans with endothelial and epithelia cells, as well as biofilm formation and catheter infection (Lo et al., 1997;Phan et al., 2000;Dieterich et al., 2002;Lewis et al., 2002;Ramage et al., 2002;Garcia-Sanchez et al., 2004). Despite its importance, molecula...

The Tlo Proteins Are Stoichiometric Components of Candida albicans Mediator Anchored via the Med3 Subunit

“…A considerable amount is known about these sequencespecific DNA-bound transcription factors, but much less is known about their downstream targets. Recently, chromatin modification and remodeling has been revealed to play an important role in facilitating the action of these DNA-bound transcription factors (26,27), but this is certainly only one aspect of a complex mechanism. Given the well-established role of Mediator in facilitating the regulation of specific gene expression programs, the demonstration that caMed3 and the Tlo proteins influence hyphal morphology suggests that these subunits work directly with DNA-bound factors to regulate genes involved in the yeastto-hypha transition.…”

Mss11, a Transcriptional Activator, Is Required for Hyphal Development in Candida albicans

“…Overnight cultures were grown in YPD for 6 h at 25°C to an optical density at 600 nm of 0.8 for yeast growth or in YPD plus 10% serum for 3 h at 37°C for hyphal induction. Chromatin immunoprecipitations (ChIPs) were performed as described previously (39). Cells were formaldehyde cross linked and lysed using lysis buffer (50 mM HEPES-KOH [pH 7.5], 140 mM NaCl, 1 mM EDTA, 1% Triton X-100, and 0.1% sodium deoxycholate).…”

“…To test this possibility, a ChIP assay was performed to determine the presence of Myc-tagged Mss11 on the HWP1 promoter. The ADE2 promoter was served as a negative control as described in a previously published study utilizing the ChIP assay (39). As shown in Fig.…”

Hyphal Chain Formation in Candida albicans: Cdc28-Hgc1 Phosphorylation of Efg1 Represses Cell Separation Genes

“…A 1-kb C-terminal fragment of the ACE2 coding region was PCR amplified with BamHI and MluI sites using the primers 5Ј-GGCGACGC GTCGTTGCAACATTAAAAACTCCTCA and 5Ј-CGGGATCCCAGAATTT AGGTGCCATGGG and cloned into pPR673 (30).…”