Elevated circulating lnc‐ANRIL/miR‐125a axis level predicts higher risk, more severe disease condition, and worse prognosis of sepsis

Abstract

Aim This study aimed to investigate the correlation of lnc‐ANRIL/miR‐125a axis with risk, severity, inflammation, and prognosis of sepsis. Methods A hundred and twenty‐six sepsis patients and 125 healthy controls were recruited, and then, blood samples were collected, and plasma was separated for lnc‐ANRIL, miR‐125a, lnc‐ANRIL/miR‐125a axis, and inflammatory cytokine level detections. In addition, basic characteristics, 28‐day mortality, and accumulating survival of sepsis patients were recorded. Results Plasma lnc‐ANRIL expression was increased, miR‐125a expression was decreased, and lnc‐ANRIL/miR‐125a axis level was elevated in sepsis patients compared with healthy controls, and all of them had good value for predicting sepsis risk with AUCs of 0.800, 0.817, and 0.843, respectively. Lnc‐ANRIL and lnc‐ANRIL/miR‐125a axis were positively correlated with biochemical index levels including CRP and PCT levels, disease severity scale scores, and pro‐inflammatory cytokine levels in sepsis patients, while miR‐125a displayed the opposite trend. Lnc‐ANRIL and lnc‐ANRIL/miR‐125a axis expressions were elevated, while miR‐125a expression was declined in deaths compared with survivors, and all of them predicted 28‐day mortality in sepsis patients with AUCs of 0.765, 0.745, and 0.785, respectively. Subsequently, the Kaplan‐Meier analysis revealed that patients with high lnc‐ANRIL, low miR‐125a, and high lnc‐ANRIL/miR‐125a axis levels presented with worse accumulating survival. In addition, multivariate regression model analyses revealed that high plasma lnc‐ANRIL/miR‐125a axis was an independent predictive factor for both increased 28‐day mortality and worse accumulating survival. Conclusion Circulating lnc‐ANRIL/miR‐125a axis was upregulated and could serve as a biomarker for severity, inflammation, and prognosis in sepsis patients.

Measurement of circulating miRNA‐125a exhibits good value in the management of etanercept‐treated psoriatic patients

“…The possible reasons may include that according to the previous studies miR-125a may inhibit the phagocytic and bactericidal activities through suppressing macrophage M1 functionality, and psoriatic patients had increased levels of inflammatory cytokines compared with HC; therefore, miR-125a expression was decreased in psoriatic patients. 22 According to the previous studies, miR-125a plays an important role in regulating TNF-a level as well as inflammatory responses; meanwhile, it has potential for predicting treatment response to TNF inhibitor as well as survival profiles in patients with inflammatory-related diseases. Further, considering the previous studies, miR-125a reduced the production of inflammatory mediators and decreased the subsequent secretion of inflammatory cytokines, and miR-125a served an inhibitory role in cell proliferation, miR-125a may alleviate inflammatory effects on skin lesions and decrease epidermal hyperplasia; therefore, miR-125a was negatively associated with disease severity in psoriatic patients.…”

“…miRNA-125a is also reported to serve as a potential prognostic biomarker in autoimmune and inflammatory diseases. 14,22 For example, miR-125a level is reported to be of value in predicting clinical remission after TNF inhibitor and/or immunosuppressive agent treatment in active Crohn's disease patients. 14 In another study, sepsis patients with low miR-125a expression presented with worse accumulating survival compared with those with high miR-125a expression.…”

“…14 In another study, sepsis patients with low miR-125a expression presented with worse accumulating survival compared with those with high miR-125a expression. 22 According to the previous studies, miR-125a plays an important role in regulating TNF-a level as well as inflammatory responses; meanwhile, it has potential for predicting treatment response to TNF inhibitor as well as survival profiles in patients with inflammatory-related diseases. Thus, we speculated that miR-125a expression may present potential for predicting response to ETN treatment in psoriatic patients.…”

Long noncoding RNA NEAT 1 and its target microRNA‐125a in sepsis: Correlation with acute respiratory distress syndrome risk, biochemical indexes, disease severity, and 28‐day mortality

“…The relative expressions of lncRNA NEAT1 and miR‐125a in plasma of patients and HCs were determined by reverse transcription‐quantitative polymerase chain reaction (RT‐qPCR). The RT‐qPCR was performed according to the method described in our previous study, 17 and the primers were as follows: LncRNA NEAT1, Forward (5′‐>3′): TGTCCCTCGGCTATGTCAGA; Reverse (5′‐>3′): GAGGGGACGTGTTTCCTGAG. MiR‐125a, Forward (5′‐>3′): ACACTCCAGCTGGGTCCCTGAGACCCTTTAAC; Reverse (5′‐>3′): TGTCGTGGAGTCGGCAATTC.…”

The Role of Long Non-coding RNAs in Sepsis-Induced Cardiac Dysfunction

“…Several studies demonstrated that the lnc-ANRIL/miR-125a axis could serve as a predictor for prognosis, severity, and inflammation among sepsis patients (91)(92)(93). LncRNA ANRIL is the prime candidate gene at Chr9p21 and widely recognized as a critical part of endothelial inflammation and cell proliferation (91,(94)(95)(96)(97).…”