Elucidating the Mechanisms of Influenza Virus Recognition by Ncr1

Glasner, Ariella; Zurunic, Antonija; Meningher, Tal; Roviš, Tihana Lenac; Tsukerman, Pinchas; Bar-On, Yotam; Yamin, Rachel; Meyers, Adrienne F. A.; Mandeboim, Michal; Jonjić, Stipan; Mandelboim, Ofer

doi:10.1371/journal.pone.0036837

Cited by 57 publications

(77 citation statements)

References 40 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The mutation primers were as follows: W32R, 59, CATCATCAGGGCCAAACCC, 39, GGGTTTGGCCCTGATGATG; W32A, 59, AA CCC ATC ATC, 39, GTTTGGCCGCGATGATGGGTT GCG GCC AAA C; W32E, 59, AAA CCC ATC ATC GAG GCC AAA C, 39, GTTTGGCCTCGATGATGGGTTT. The triple N-linked mutated Ncr1 (3Nmut) was generated as previously described (5,22).…”

Section: Ncr1 Plasmids Reporter Cells Ig Fusion Proteins and Mabsmentioning

confidence: 99%

“…Contrary to the Ncr1 gfp/gfp mice, the Noé mice express the full-length Ncr1 protein, yet it carries a mutation in position W32. The Ncr1 gfp/gfp mice exhibited impaired Ncr1-related activities (5,7,10,(21)(22)(23)(24) and therefore it is clear that Ncr1 does not function in these mice. Nevertheless, it is plausible that a truncated version of Ncr1 may exist in the Ncr1 gfp/gfp mice.…”

Section: The Ncr1mentioning

confidence: 99%

“…NKp46/Ncr1 directly recognizes the hemagglutinin (HA) proteins of influenza viruses (4,5,20), poxviruses (8), and Newcastle disease viruses (9). Furthermore, although the identities of the cellular ligands of NKp46/Ncr1 are still unknown, it is well established that NKp46/Ncr1 is involved in a myriad of immunological activities (5,7,10,(21)(22)(23)(24).…”

mentioning

confidence: 99%

“…The heterozygous Ncr1 +/gfp mice are immune competent, expressing functional Ncr1 from one allele and GFP from the other, and thus all their NK cells are GFP + (5). The Ncr1 +/gfp heterozygous mice are excellent for detecting NK cells (as well as some ILC subsets) and for studying their trafficking in vivo under various conditions (5,7,10,(21)(22)(23)(24).…”

mentioning

confidence: 99%

“…Using the Ncr1 gfp/gfp mice, it was revealed that Ncr1 is involved in controlling influenza virus infections (5,22,25), tumor and metastases eradication (6,7,10,24), the development of type I and type II diabetes (11,23,26,27), liver fibrosis (28), and bacterial infections (3,29). In all of these studies, the activity of the Ncr1 gfp/gfp NK cells was impaired in an Ncr1-dependent manner.…”

mentioning

confidence: 99%

See 4 more Smart Citations

Expression, Function, and Molecular Properties of the Killer Receptor Ncr1-Noé

Glasner¹,

Šimić

Miklić

et al. 2015

The Journal of Immunology

Self Cite

View full text Add to dashboard Cite

NK cells kill various cells using activating receptors, such as the natural cytotoxicity receptors (NCRs). NKp46 is a major NCR and is the only NCR expressed in mice (denoted Ncr1). Using Ncr1-deficient mice (Ncr1gfp/pfp) we demonstrated that Ncr1 controls various pathologies, and that in its absence Ncr1-related functions are impaired. In 2012, another Ncr1-related mouse was generated, named Noé, in which a random mutation, W32R, in position 32, impaired the Ncr1-Noé cell surface expression. Interestingly, in the Noé mice, Ncr1-dependent deficiencies were not observed. Additionally, the Noé-NK cells were hyperactivated, probably due to increased Helios expression, and the Noé mice demonstrate increased clearance of influenza and murine CMV. In contrast, in the Ncr1gfp/pfp mice infection with influenza was lethal and we show in the present study no difference in murine CMV infection between Ncr1gfp/pfp and wild-type (WT) mice. Because the foremost difference between the Noé and Ncr1gfp/gfp mice is the presence of a mutated Ncr1-Noé protein, we studied its properties. We show that Ncr1-Noé and various other Ncr1 mutants in position 32 can be expressed on the surface, albeit slowly and unstably, and that ligand recognition and function of the various Ncr1-Noé is similar to the WT Ncr1. We further show that the glycosylation pattern of Ncr1-Noé is aberrant, that the Ncr1-Noé proteins accumulate in the endoplasmic reticulum, and that the expression of Ncr1-Noé proteins, but not WT Ncr1, leads to increased Helios expression. Thus, we suggest that the NK hyperactivated phenotype observed in the Noé mice might result from the presence of the Ncr1-Noé protein.

show abstract

Section: Ncr1 Plasmids Reporter Cells Ig Fusion Proteins and Mabsmentioning

confidence: 99%

Section: The Ncr1mentioning

confidence: 99%

mentioning

confidence: 99%

mentioning

confidence: 99%

mentioning

confidence: 99%

See 3 more Smart Citations

Expression, Function, and Molecular Properties of the Killer Receptor Ncr1-Noé

Glasner¹,

Šimić

Miklić

et al. 2015

The Journal of Immunology

Self Cite

View full text Add to dashboard Cite

show abstract

The evolutionary arms race between NK cells and viruses: Who gets the short end of the stick?

2013

View full text Add to dashboard Cite

NK cells in viral infectionsNK cells are innate cytotoxic lymphocytes essential for the control of a broad range of viral infections. The activation and function of NK cells are based on a tightly regulated interplay between inhibitory and activating signals induced by the receptors expressed on their surface (reviewed in [1]) or by a variety of cytokines generated by the interaction between NK cells and other innate immune cells, such as macrophages and DCs [2,3]. Type I IFNs, IL-12, IL-15, and IL-18 produced by macrophages and DCs are indispensable for NK-cell maturation and regulation of NK-cell function. More recently, it has been demonstrated that TGF-β signaling limits the maturation dynamics of NK cells during the neonatal period [4]. Mice lacking the TGF-β receptor on the surface of their NK cells and DCs possess more mature NK cells and can therefore control viral infection more efficiently compared with control mice [4], providing an explanation for the deficient NK-cell response early in life.Correspondence: Prof. Stipan Jonjić e-mail: stipan.jonjic@medri.uniri.hrThe impact of NK cells on virus control has been proven to play a key role in different infection models including those modeling infection with influenza virus, HIV, HCV, coxsackievirus, and poxviruses. Arguably, the role of NK cells in the control of herpesviruses, especially CMV, has been most widely studied up till now (reviewed in [5][6][7]). Upon activation and recruitment to the site of infection, NK cells use several mechanisms to limit virus replication: (i) a cytolytic response involving the secretion of cytolytic granules (granzymes and perforin) upon engagement of an activating receptor [8,9], (ii) production of pro-inflammatory cytokines with antiviral activity such as , (iii) killing of target cells via FasL or TRAIL [11], and (iv) Abdependent, cell-mediated cytotoxicity-mediated lysis via CD16 [12].Besides their well-recognized role in the control of virus replication, NK cells have been shown to possess additional functions that can be beneficial or detrimental to the host. For instance, decidual NK cells are considered to be important for placentation and maintenance of materno-fetal immune tolerance [13], but there is a very limited amount of data published on the role of NK cells in the control of infections during pregnancy. In mouse cytomegalovirus (MCMV)-infected mice, NK cells preserve the integrity and function of the salivary gland, an organ that iswww.eji-journal.eu 868Antonija Miletić et al. Eur. J. Immunol. 2013. 43: 867-877 important for horizontal virus spread [14,15]. A study using the mouse model of salivary gland dysfunction after an acute MCMV infection showed the involvement of NK cells in the prevention of acinar atrophy and loss of secretions [16]. Conversely, the NK-cell response could play a negative role in virus infection, as demonstrated in the case of infection with RSV [17]. NK cells accumulate in the lungs of BALB/c mice at the early stage of RSV infection, where they gain an activated phenotyp...

show abstract

NK cells – Versatile tools for viral defense and cancer treatment

2013

View full text Add to dashboard Cite

About 150 NK cell researchers met at the German Cancer Research Center (DKFZ) in Heidelberg, Germany from 26–28 September 2012 for the Natural Killer Cell Symposium which was organized by the NK cell study group of the German Society for Immunology (DGfI) and sponsored by the European Journal of Immunology (EJI), the European Federation of Immunological Societies (EFIS) and the DGfI. The meeting was a forum for the discussion of the function and regulation of these fascinating innate immune cells and the opportunities for the transfer of this knowledge to cancer immunotherapy.

show abstract

Elucidating the Mechanisms of Influenza Virus Recognition by Ncr1

Cited by 57 publications

References 40 publications

Expression, Function, and Molecular Properties of the Killer Receptor Ncr1-Noé

Expression, Function, and Molecular Properties of the Killer Receptor Ncr1-Noé

The evolutionary arms race between NK cells and viruses: Who gets the short end of the stick?

NK cells – Versatile tools for viral defense and cancer treatment

Contact Info

Product

Resources

About