Endogenous APOBEC3B Overexpression Constitutively Generates DNA Substitutions and Deletions in Myeloma Cells

Yamazaki, Hiroaki; Shirakawa, Kotaro; Matsumoto, Tadahiko; Hirabayashi, Shigeki; Murakawa, Yuji; Kobayashi, Masayuki; Sarca, Anamaria Daniela; Kazuma, Yasuhiro; Matsui, Hiroyuki; Maruyama, Wakako; Fukuda, Hirofumi; Shirakawa, Ryutaro; Shindo, Keisuke; Ri, Masaki; Iida, Shinsuke; Takaori‐Kondo, Akifumi

doi:10.1038/s41598-019-43575-y

Cited by 28 publications

(30 citation statements)

References 64 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…2E). According to flow cytometry analysis, the intensity of the fluorescent signal increased in the order of U266 KI #1, RPMI8226 KI and AMO1 KI, which is consistent with their A3B expression levels in a previous report [7]. U266 KI #2 exhibited around two times stronger fluorescence than U266 KI #1, indicating that the 3×FLAG–IRES– EGFP gene was integrated homozygously in U266 KI #2 and heterozygously in U266 KI #1.…”

Section: Resultssupporting

confidence: 88%

“…2G). Immunofluorescent analysis of the subcellular localization of A3B–3×FLAG proteins showed a dominant localization in the nucleoplasm (Fig, 2H), which is identical with that of intact A3B proteins [7].…”

Section: Resultsmentioning

confidence: 97%

“…In order to insert the 3×FLAG sequence into A3B with a minimal off-target effect, we selected sgRNA #4 (Fig.1A). We detected endogenous A3B overexpression in U266, RPMI8266 and AMO1[7] and used the pSpCas9(BB)–2A–Puro plasmid and the lentiCRISPR ver.2 plasmid to transduce CRISPR targeting APOBEC3B loci in these cell lines. We also used a donor DNA template to introduce the 3×FLAG and IRES-EGFP reporter sequences at the end of the coding region, while removing the stop codon (Figs.…”

Section: Resultsmentioning

confidence: 99%

“…We constructed pSicoR-mCherry lentiviral vectors [25] expressing short-hairpin RNA (shRNA) against A3B by inserting synthetic double-stranded oligonucleotides, as previously described [7] (TRCN0000140546 [26], sense oligo, 5’-TGCAAAGCAATGTGCTCCTGATCTCGAGATCAGGAGCACATTGCTTTGCTTTTTTC-3’, and antisense oligo, 5’-TCGAGAAAAAAGCAAAGCAATGTGCTCCTGATCTCGAGATCAGGAGCACATTGCTT TGCA-3’; TRCN0000139463, sense oligo, 5’-TCCTGATGGATCCAGACACATTCTCGAGAATGTGTCTGGATCCATCAGGTTTTTTC-3’, and antisense oligo, 5’-TCGAGAAAAAACCTGATGGATCCAGACACATTCTCGAGAATGTGTCTGGATCCATCA GGA-3’) into the cloning site. For non-target shRNA, we used two constructs that were cloned as scrambled sequences (control [27], sense oligo, 5’-TGTCAAGTCTCACTTGCGTCTTCAAGAGAGACGCAAGTGAGACTTGACTTTTTTC-3’, antisense oligo, 5’-TCGAGAAAAAAGTCAAGTCTCACTTGCGTCTCTCTTGAAGACGCAAGTGAGACTTGA CA-3’; control-2 [28], sense oligo, 5’-TATCTCGCTTGGGCGAGAGTAAGCTCGAGCTTACTCTCGCCCAAGCGAGATTTTTTT C-3’, antisense oligo, 5’-TCGAGAAAAAAATCTCGCTTGGGCGAGAGTAAGCTCGAGCTTACTCTCGCCCAAGC GAGATA).…”

Section: Methodsmentioning

confidence: 99%

“…Among APOBEC3s, we previously reported that endogenous A3B is overexpressed and seems to be the main source of deamination activity in most of the myeloma cell lines we examined [7]. Notably, high levels of A3B expression in tumor cells were an independent risk factor for overall survival in myeloma patients [7] as well as in other cancer patients [8-11]. However, the regulatory mechanisms that mediate A3B expression have not been well studied.…”

Section: Introductionmentioning

confidence: 99%

See 4 more Smart Citations

APOBEC3B reporter myeloma cell lines identify DNA damage response pathways leading to APOBEC3B expression

Yamazaki

Shirakawa

Matsumoto

et al. 2019

Preprint

Self Cite

View full text Add to dashboard Cite

18 2 19 Text word count: 3635 words 20 Abstract word count: 190 words 21 Number of figures: 4 22 Number of tables: 0 (Supplemental Table: 2) 23 Number of references: 69 3 25 Abstract 26 Apolipoprotein B mRNA-editing enzyme catalytic polypeptide-like (APOBEC) DNA cytosine 27 deaminase 3B (A3B) is a DNA editing enzyme which induces genomic DNA mutations in 28 multiple myeloma and various other cancers. APOBEC family proteins are highly homologous 29 so it is especially difficult to investigate the biology of A3B alone in cancer cells. To investigate 30 A3B function in myeloma cells easily and comprehensively, we used CRISPR/Cas9 to generate 31 A3B reporter cells that contain 3×FLAG tag and IRES-EGFP sequences integrated at the end of 32 the A3B gene. These reporter cells stably express 3xFLAG tagged A3B and the reporter EGFP 33 and this expression is enhanced under known stimuli, such as PMA. Conversely, shRNA 34 knockdown of A3B decreased EGFP fluorescence and 3xFLAG tagged A3B protein levels. We 35 screened a series of anticancer treatments using these cell lines and identified that most 36 conventional therapies, such as antimetabolites or radiation, exacerbated endogenous A3B 37 expression, but recent molecular targeting drugs, including bortezomib, lenalidomide and 38 elotuzumab, did not. Furthermore, chemical inhibition of ATM, ATR and DNA-PK suppressed 39 the EGFP expression upon treatment with antimetabolites. These results suggest that DNA 40 damage response triggers A3B expression through ATM, ATR and DNA-PK signaling. 42 Introduction43 The apolipoprotein B mRNA-editing enzyme catalytic polypeptide-like DNA cytosine 44 deaminase 3 family (APOBEC3, A3) consists of seven proteins (A3A, A3B, A3C, A3D, A3F, 45 A3G and A3H) that preferentially induce C to U mutations in single strand DNA. A3 proteins 46 were originally identified as factors of the innate immunity due to their mutagenic activity on 47 viral genomes, and have recently joined the growing list of key intrinsic mutagens that play a 48 part in oncogenesis [1]. Evidence for A3 mutagenicity consists in the presence of their 49 mutational signature in cancer genomes [2], in the effects observed when overexpressed in tumor 50 tissues [3, 4], as well as in the correlation of APOBEC signature mutations with poor prognosis 51 [5, 6]. Nevertheless, the precise biology of individual APOBEC3 proteins in cancer cells remains 52 unknown. Due to the high structural homology of APOBEC3 family members, it is particularly 53 difficult to obtain high-affinity-and high-specificity-antibodies against each APOBEC3 protein, 54 which limits our capability to distinguish the precise role of each endogenous APOBEC3 during 55 tumorigenesis. 56Among APOBEC3s, we previously reported that endogenous A3B is overexpressed and 57 seems to be the main source of deamination activity in most of the myeloma cell lines we 58 examined [7]. Notably, high levels of A3B expression in tumor cells were an independent risk 59 factor for overall survival in myeloma patients [7] as well as in...

show abstract

Section: Resultssupporting

confidence: 88%

Section: Resultsmentioning

confidence: 97%

Section: Resultsmentioning

confidence: 99%

Section: Methodsmentioning

confidence: 99%

Section: Introductionmentioning

confidence: 99%

See 3 more Smart Citations

APOBEC3B reporter myeloma cell lines identify DNA damage response pathways leading to APOBEC3B expression

Yamazaki

Shirakawa

Matsumoto

et al. 2019

Preprint

Self Cite

View full text Add to dashboard Cite

show abstract

Molecular basis of clonal evolution in multiple myeloma

Furukawa

Kikuchi

2020

Int J Hematol

View full text Add to dashboard Cite

The treatment outcome of multiple myeloma (MM) is worse than expected from the average numbers of non-synonymous mutations, which are roughly correlated with the prognosis of cancer patients. The refractoriness of MM may be ascribed to the complex genomic architecture and clonal behavior of the disease. In MM, disease progression is accomplished by branching patterns of subclonal evolution from reservoir clones with a propagating potential and/or the emergence of minor clones, which already exist at the MGUS stage and outcompete other clones through selective pressure mainly by therapeutic agents. Each subclone harbors novel mutations and distinct phenotypes including drug sensitivities. In general, mature clones are highly sensitive to proteasome inhibitors (PIs), whereas immature clones are resistant to PIs but could be eradicated by immunomodulatory drugs (IMiDs). The branching evolution is a result of the fitness of different clones to microenvironment and their evasion of immune surveillance; therefore, IMiDs are effective for MM with this pattern of evolution. In contrast, ~ 20% of MM evolve neutrally in the context of strong oncogenic drivers, such as high-risk IgH translocations, and are relatively resistant to IMiDs. Further understanding of the genomic landscape and the pattern of clonal evolution may contribute to the development of more effective treatment strategies for MM.

show abstract