Endogenous SNAP-25 Regulates Native Voltage-gated Calcium Channels in Glutamatergic Neurons

Abstract

In addition to its primary role as a fundamental component of the SNARE complex, SNAP-25 also modulates voltage-gated calcium channels (VGCCs) in various overexpression systems. Although these studies suggest a potential negative regulatory role of SNAP-25 on VGCC activity, the effects of endogenous SNAP-25 on native VGCC function in neurons are unclear. In the present study, we investigated the VGCC properties of cultured glutamatergic and GABAergic rat hippocampal neurons. Glutamatergic currents were dominated by P/Q-type channels, whereas GABAergic cells had a dominant L-type component. Also, glutamatergic VGCC current densities were significantly lower with enhanced inactivation rates and shifts in the voltage dependence of activation and inactivation curves compared with GABAergic cells. Silencing endogenous SNAP-25 in glutamatergic neurons did not alter P/Q-type channel expression or localization but led to increased VGCC current density without changes in the VGCC subtype proportions. Isolation of the P/Qtype component indicated that increased current in the absence of SNAP-25 was correlated with a large depolarizing shift in the voltage dependence of inactivation. Overexpressing SNAP-25 in GABAergic neurons reduced current density without affecting the VGCC subtype proportion. Accordingly, VGCC current densities in glutamatergic neurons from Snap-25 ؉/؊ mice were significantly elevated compared with wild type glutamatergic neurons. Overall, this study demonstrates that endogenous SNAP-25 negatively regulates native VGCCs in glutamatergic neurons which could have important implications for neurological diseases associated with altered SNAP-25 expression.The primary role of SNAP-25 3 is as a fundamental component of the SNARE complex responsible for vesicle fusion (1). In addition to mediating exocytosis by binding to other SNARE proteins, SNAP-25 has also been shown to interact with and modulate a variety of other proteins involved in diverse functions (2-4). Important among these interactions are the voltage-gated calcium channels (VGCCs), where SNAP-25 overexpression generally results in a negative modulation of VGCC function (5). However, the majority of the studies describing this regulatory role have been performed by overexpressing SNAP-25 and VGCCs in heterologous systems (6, 7). Although Pozzi et al. (8) recently demonstrated that SNAP-25 negatively modulates native VGCC function in neurons, the effect was still observed while overexpressing exogenous SNAP-25. It is possible that these effects on VGCC function could result from nonspecific interactions forced via the molecular arrangement of the proteins in the plasma membrane as a consequence of overexpression.The objective of the present study was to investigate whether endogenous SNAP-25 is effective in regulating native VGCC function in neurons. In particular, if SNAP-25 is physiologically involved in regulating VGCC function, then the reduction of endogenous SNAP-25 expression in neurons would remove a regulatory "brake" on calcium channel f...

Reduced SNAP‐25 alters short‐term plasticity at developing glutamatergic synapses

“…Consistently, silencing endogenous SNAP-25 results in increased VGCC activity in glutamatergic neurons [8,9].…”

Reduced SNAP-25 increases PSD-95 mobility and impairs spine morphogenesis

“…Our data so far suggest that SNAP-25 reductions affect the localization and/or stabilization of PSD-95 in dendritic protrusions, influencing synapse organization and strength during development and plasticity. Consistent with this possibility, acute downregulation of SNAP-25 expression by siRNA, 10 To investigate whether SNAP-25 controls the latter processes via its SNARE function, neurons were transfected with 45; Mann-Whitney rank-sum test P ≤ 0.001; 3 independent experiments). The decrease in mature spine number (mushroom-type) is accompanied by an increase in thin spine number (filopodia-like) (number of mushroom spines per micron, wt: 0.31 ± 0.02, number of examined dendrites: 63; number of neurons: 37; Het: 0.16 ± 0.01, number of examined dendrites: 84; number of neurons: 45; number of filopodia-like spines per micron, wt: 0.06 ± 0.01; Het: 0.11 ± 0.01; Mann-Whitney rank-sum test P ≤ 0.001;a cDNA codifying for the BonT/E light chain, which cleaves SNAP-25 at its N-terminal side and prevents the protein entering the fusion complex.…”

“…56 By taking advantage of mixed cultures of wt and Het neurons, we demonstrated that postsynaptic defects in In recent years SNARE/SM proteins have been shown to be involved in activity-dependent AMPA receptor exocytosis during LTP 22 and SNAP-25, in particular, has been reported to have a role in the removal of kainate receptors from the postsynaptic membrane, 57 in the insertion of NMDA receptors in neuronal plasma membrane 21 and of P/Q and L typevoltage gated calcium channels. 10,58 Also, acute regulation of SNAP-25 expression has been found to impair synaptic plasticity probably affecting NMDAR trafficking. 22 Our data indicate that SNAP-25 has also a structural role in the postsynaptic compartment by interacting with the postsynaptic protein p140Cap, which in turn binds to PSD-95.…”

“…Neuronal cultures were transfected at 17DIV with pEGFP-C1 (Clontech, Palo Alto, CA, USA) or pSUPER-DsRed plasmid (obtained from pSUPER-GFP, Oligoengine, Seattle, WA, USA) and FU(PSD95:EGFP) W. 63 Silencing of SNAP-25 was achieved via transfection of a pSUPER construct. 10,58 A non-specific siRNA duplex of the same nucleotides but in an irregular sequence (scrambled SNAP-25 siRNA) was prepared using oligonucleotides 5-GATCCCCG AGGAGTTATGCGATAGTATTCAAGAGAATGATAGCGTATTGAGGAGTTTTTGGAAA-3 and 5-AGCTTTTCCAAAAACTCCTCAATACGCTATCATTCTCTTGAATACTATCGCATA ACTCCTCGGG-3 that were annealed and ligated into the pSuper vector as described previously. 10,58 For LUMIER assay, mouse Srcin1 was PCR amplified using Phusion Hot Start II High-Fidelity DNA Polymerase (Thermo Scientific, Waltham, MA, USA) and the following primers: 5-GGGGA;CAAGTTTGTACAAAAAAGCAGGCTTCATGGGGA ACGCTCCGTCCCAAG-3 and 5-GGGACCACTTTGTACAAGAAAGCTGGGTCGG AAGGAGATGGAAGAATTCCTTGC-3.…”

“…10,58 A non-specific siRNA duplex of the same nucleotides but in an irregular sequence (scrambled SNAP-25 siRNA) was prepared using oligonucleotides 5-GATCCCCG AGGAGTTATGCGATAGTATTCAAGAGAATGATAGCGTATTGAGGAGTTTTTGGAAA-3 and 5-AGCTTTTCCAAAAACTCCTCAATACGCTATCATTCTCTTGAATACTATCGCATA ACTCCTCGGG-3 that were annealed and ligated into the pSuper vector as described previously. 10,58 For LUMIER assay, mouse Srcin1 was PCR amplified using Phusion Hot Start II High-Fidelity DNA Polymerase (Thermo Scientific, Waltham, MA, USA) and the following primers: 5-GGGGA;CAAGTTTGTACAAAAAAGCAGGCTTCATGGGGA ACGCTCCGTCCCAAG-3 and 5-GGGACCACTTTGTACAAGAAAGCTGGGTCGG AAGGAGATGGAAGAATTCCTTGC-3. The PCR product was inserted into pDONR221 using the BP clonase (Invitrogen), amplified and further shuttled into the LUMIER prey vector (FireV5DM).…”