Endosymbionts Reduce Microbiome Diversity and Modify Host Metabolism and Fecundity in the Planthopper
            <i>Sogatella furcifera</i>

Li, Tong‐Pu; Zhou, Chong‐Wen; Wang, Mengke; Zha, Si-Si; Chen, Jie; Bing, Xiao‐Li; Hoffmann, Ary A.; Hong, Xiao‐Yue

doi:10.1128/msystems.01516-21

Cited by 17 publications

(18 citation statements)

References 73 publications

(97 reference statements)

Supporting

Mentioning

Contrasting

Order By: Relevance

Section: Discussionmentioning

confidence: 99%

“…A number of studies also have revealed the role of bacterial microorganisms in host development through participating in host metabolism or providing metabolites to the host. 56,57 For example, the bacterial microbiota can provide amino acids and B vitamins to the host. [58][59][60] Bacterial loads in the ovaries increased after tetracycline treatment, possibly providing the host with higher levels of bacterial metabolites.…”

Section: Discussionmentioning

confidence: 99%

See 1 more Smart Citation

Tetracycline inhibits tick host reproduction by modulating bacterial microbiota, gene expression and metabolism levels

Zhang,

Li,

Yang

et al. 2023

Pest Management Science

View full text Add to dashboard Cite

BACKGROUNDTicks are disease vectors that are a matter of worldwide concern. Antibiotic treatments have been used to explore the interactions between ticks and their symbiotic microorganisms. In addition to altering the host microbial community, antibiotics can have toxic effects on the host.RESULTSIn the tick Haemaphysalis longicornis, engorged females showed reproductive disruption after microinjection of tetracycline. Multi‐omics approaches were implemented to unravel the mechanisms of tick reproductive inhibition in this study. There were no significant changes in bacterial density in the whole ticks on Day (D)2 or D4 after tetracycline treatment, whereas the bacterial microbial community was significantly altered, especially on D4. The relative abundances of the bacteria Staphylococcus, Bacillus and Pseudomonas decreased after tetracycline treatment, whereas the relative abundances of Coxiella and Rhodococcus increased. Ovarian transcriptional analysis revealed a cumulative effect of tetracycline treatment, as there was a significant increase in the number of differentially expressed genes with treatment time and a higher number of downregulated genes. The tick physiological pathways including lysosome, extracellular matrix (ECM)–receptor interaction, biosynthesis of ubiquinone and other terpenoids‐quinones, insect hormone biosynthesis, and focal adhesion were significantly inhibited after 4 days of tetracycline treatment. Metabolite levels were altered after tetracycline treatment and the differences increased with treatment time. The differential metabolites were involved in a variety of physiological pathways; the downregulated metabolites were significantly enriched in the nicotinate and nicotinamide metabolism, galactose metabolism, and ether lipid metabolism pathways.CONCLUSIONSThese findings indicate that tetracycline inhibits tick reproduction through the regulation of tick bacterial communities, gene expression and metabolic levels. The results may provide new strategies for tick control. © 2023 Society of Chemical Industry.

show abstract

Section: Discussionmentioning

confidence: 99%

Section: Discussionmentioning

confidence: 99%

Tetracycline inhibits tick host reproduction by modulating bacterial microbiota, gene expression and metabolism levels

Zhang,

Li,

Yang

et al. 2023

Pest Management Science

View full text Add to dashboard Cite

show abstract

“…However, it is not clear which pathways (tolerance, resistance) are involved in the double-infested host. In another study, the manipulative experiments established double-infected S. furcifera [23]; the study con rmed the effect of symbionts on metabolites (e.g. arginine biosynthesis and nicotinamide metabolism).…”

Section: Introductionmentioning

confidence: 90%

The Cardinium wins on Wolbachia in double-infected mite cultures

Tresnakova,

Glowska,

Hubert

2024

Preprint

View full text Add to dashboard Cite

The different cultures of stored product mite Tyrophagus putrescentiae are single-infected by intracellular bacteria Cardinium or Wolbachia. No natural double-infected Cardinium/Wolbachia-infected mites are known. Under the experiment, single-infected mite (Wolbachia 5N, 5P and Cardinium 5L, 5S) cultures were mixed to double-infected cultures (5LP, 5LN, 5SP, 5SN). The mite fitness and symbionts' presence were analyzed during 5-month-long experiment. Cardinium, Wolbachia and mite genomes were assembled and gene expression in single and double-infected cultures was analyzed. In double-infected cultures, Cardinium infection increased with the time of the experiment from 50 to 95% of infected mites. Cardinium + Wolbachia-infected mite individuals proportion ranged from 0 to 20% of mites in double-infected cultures. Wolbachia infection disappeared in all double-infected cultures up to 5 months of the experiment duration. The double-infected cultures had lower fitness than single-infected cultures. After a month of experiment, the fitness of originally double-infected cultures increased to the level of parental cultures. The correlation analyses of gene expression showed that Wolbachia had well-established interactions with mite predicted KEGG gene expression in a single-infected population. The expression of mite protein was strongly influenced by the presence of Wolbachia, but not by Cardinium. The total numbers of Cardinium-expressed genes did not change, while there was a ten-fold decrease in Wolbachia in double-infected cultures. Cardinium and Wolbachia gene expression showed 30% negative and 70% positive (N = 3793) correlations. The number of correlations between Wolbachia and mite gene expression 5 times decreased in double-infected cultures. The Cardinium had a 6-fold higher number of genes than Wolbachia with significantly higher expression in the multiple infected samples. The gene expression analysis provides a suggestion that the presence of Cardinium inhibits the growth of Wolbachia by the disruption of the Wolbachia interaction with mite host. However, we cannot eliminate stochastic processes resulting in the increase of Wolbachia abundance and symbiont change. Importance We sought insight into the intracellular symbionts’ competition in the novel mite host model. The manipulative experiments established double-infected Wolbachia Cardinium cultures, which were unstable due to their low fitness. Cardinium prevailed during five months in all 4 double-infected cultures. The competition disrupted Wolbachia's interaction with its host on the level of gene expression. The genome expression is highly correlated between Wolbachia and mite hosts in single Wolbachia-infected cultures. These correlations disappeared in multi-infected cultures. Differently, the interaction among host and Cardinium genes showed low differences in the gene expression level. Although Cardinium/Wolbachia-infested individuals are rare, the gene expression of Cardinium and Wolbachia had a high number of positive correlations. It indicates that the symbionts reacted to each other. The data indicates that we have established a new model to study Wolbachia and Cardinium interactions.

show abstract

“…The relative copy number of the P450 gene was determined according to a method by Li et al 29 First, the DNA of 10 unmated female adults on the 1 d after emergence was extracted according to the CTAB method. 29 After the concentration and quality of the extracted DNA were determined, the relative copy numbers of CYP6FJ3 and CYP6CS3 were measured by qRT−PCR with the NovoStart SYBR qPCR SuperMix Plus kit in a 20 μL total reaction volume containing 200 ng of DNA, 10 μL of reaction buffer, and 1 μL each of 10 μM forward and reverse primer (CYP6FJ3CF: GTGTTCTCCAAA-AATGGCCGA; CYP6FJ3CR: CCGGATCGTTTTCTTTGAGCA. CYP6CS3CF: GTTCACTCCCAAAGAGACGGA; CYP6CS3CR: GGCGCCTTTGTCGATTGTATC) following the manufacturer's instructions with 3 biological and technical replicates per treatment.…”

Section: ■ Materials and Methodsmentioning

confidence: 99%

Metabolic Resistance of Sogatella furcifera (Hemiptera: Delphacidae) toward Pymetrozine Involves the Overexpression of CYP6FJ3

Gong,

Liu,

Wang

et al. 2023

J. Agric. Food Chem.

View full text Add to dashboard Cite

Endosymbionts Reduce Microbiome Diversity and Modify Host Metabolism and Fecundity in the Planthopper Sogatella furcifera

Cited by 17 publications

References 73 publications

Tetracycline inhibits tick host reproduction by modulating bacterial microbiota, gene expression and metabolism levels

Tetracycline inhibits tick host reproduction by modulating bacterial microbiota, gene expression and metabolism levels

The Cardinium wins on Wolbachia in double-infected mite cultures

Metabolic Resistance of Sogatella furcifera (Hemiptera: Delphacidae) toward Pymetrozine Involves the Overexpression of CYP6FJ3

Contact Info

Product

Resources

About