Ensiling sorghum with unsalable pumpkin improves feed digestibility with minimal influence on the rumen microbial population using the rumen simulation technique

Forwood, Daniel L.; Caro, Eleonora; Holman, Devin B.; Meale, S. J.; Chaves, Alex V.

doi:10.1007/s00253-021-11220-2

Cited by 4 publications

(4 citation statements)

References 55 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…This study evaluated the effect of ensiling sorghum with 0, 20, or 40% DM unsalable vegetable mix on silage chemical composition, fermentation quality parameters, and the associated bacterial, archaeal, and fungal communities. Previous results ( [7,34,35]) support the findings from this study that ensiling unsalable vegetables lead to readily degradable silage (increase in IVDMD by 12.9%), dominated by lactic acid bacteria. In addition to ensuring silage quality, the presence of lactic acid bacteria in silages may confer a probiotic benefit to ruminants given their subsistence in the rumen microbial community upon consumption by the ruminant [36,37].…”

Section: Discussionsupporting

confidence: 89%

Ensiled Mixed Vegetables Enriched Carbohydrate Metabolism in Heterofermentative Lactic Acid Bacteria

et al. 2022

Self Cite

View full text Add to dashboard Cite

This study evaluated the fermentation quality, nutritive profile, in vitro fermentation, and microbial communities colonising sorghum ensiled with an unsalable vegetable mixture (chopped beans, carrot, and onion (1:1:1) ) including: (1)−100% sorghum; (2)−80% sorghum + 20% vegetable mix or (3)−60% sorghum + 40% vegetable mix, on a dry matter (DM) basis, with or without a probiotic inoculant. Samples were obtained across 0, 1, 3, 5,7, and 101 days ensiling and after 14 d aerobic exposure. The V4 region of the 16S rRNA gene and the ITS1 region were sequenced to profile bacterial, archaeal, and fungal communities. Compared to the 0% DM, ethanol increased (p < 0.01) from 8.42 to 20.4 ± 1.32 mM with 40% DM vegetable mix inclusion, while lactate decreased from 5.93 to 2.24 ± 0.26 mM. Linear discriminant analysis revealed that relative abundances of 12 bacterial taxa were influenced by silage treatments (log LDA score ≥ 4.02; p ≤ 0.03), while predicted functional pathways of alternative carbohydrate metabolism (hexitol, sulfoquinovose and glycerol degradation; N-acetyl glucosamine biosynthesis; log LDA score ≥ 2.04; p ≤ 0.02) were similarly enriched. This study indicated that carbohydrate metabolism by heterofermentative lactic acid bacteria can increase the feed value of sorghum when ensiled with an unsalable vegetable mixture at 40%DM, without requiring a high quantity of lactate.

show abstract

Section: Discussionsupporting

confidence: 89%

Ensiled Mixed Vegetables Enriched Carbohydrate Metabolism in Heterofermentative Lactic Acid Bacteria

et al. 2022

Self Cite

View full text Add to dashboard Cite

show abstract

“…They produce aflatoxins, compounds with hepatotoxic and carcinogenic potential. However, A. cibarius strains found in sorghum and pumpkin samples did not produce any mycotoxins [28]. The quantification, in reads, of this species in the golden flaxseed sample was the highest among the eight found.…”

Section: Resultsmentioning

confidence: 83%

Identification of Fungi in Flaxseed (L. usitatissimum L.) Using the ITS1 and ITS2 Intergenic Regions

Rollemberg

Hassemer

Pierezan

et al. 2022

Microbiology Research

View full text Add to dashboard Cite

Flaxseed (Linum usitatissimum L.) displays functional properties and contains α-linolenic acid (omega-3). It also contains soluble and insoluble fiber, lignans, phenolic acids, flavonoids, phytic acid, vitamins, and minerals. However, its microbiota can cause fungal contaminations, drastically reducing its quality. The objective of this work was to identify the fungi present in bulk flaxseed through the internal transcribed spacer (ITS1) intergenic region using a metataxonomics approach. Fungal identification was performed via high-performance sequencing of the ITS1 region using ITS1 (GAACCWGCGGARGGATCA) and ITS2 (GCTGCGTTCTTCATCGATGC) as primers with 300 cycles and single-end sequencing in the MiSeq Sequencing System equipment (Illumina Inc., San Diego, CA, USA). Six genera and eight species of fungi were found in the sample. The genus Aspergillus stood out with three xerophilic species found, A. cibarius, A. Appendiculatus, and A. amstelodami, the first being the most abundant. The second most abundant genus was Wallemia, with the species W. muriae. This is one of the fungi taxa with great xerophilic potential, and some strains can produce toxins. Metataxonomics has proved to be a complete, fast, and efficient method to identify different fungi. Furthermore, high-performance genetic sequencing is an important ally in research, helping to develop novel technological advances related to food safety.

show abstract

“…( Cogan and Jordan, 1994 ) in the presence of a higher quantity of fermentable sugars and water-soluble carbohydrates in pumpkin ( Halik et al, 2018 ). Consequently, several reports have indicated that the presence of high water-soluble carbohydrate content following the inclusion of pumpkin increases the rumen-simulated DM fermentation by 26.5% with pumpkin inclusion in sorghum silage at 40% DM ( Forwood et al, 2021 ), effective degradability in an in situ system by 13.8% w pumpkin inclusion in sorghum silage at 40% DM ( Forwood et al, 2020 ), and IVDMD by 21 and 15.6% with pumpkin inclusion at 30% DM and 40% DM, respectively ( Crosby-Galván et al, 2018 ; Forwood et al, 2019 ).…”

Section: Discussionmentioning

confidence: 99%

Unsalable Vegetables Ensiled With Sorghum Promote Heterofermentative Lactic Acid Bacteria and Improve in vitro Rumen Fermentation

et al. 2022

Self Cite

View full text Add to dashboard Cite

This study characterized the nutritive and microbial profiles and the fermentation characteristics of silage with the following compositions on a dry matter (DM) basis: (1) 100% sorghum, (2) 70% sorghum + 30% carrot or pumpkin, and (3) 40% sorghum + 60% carrot or pumpkin. The treatments were further divided based on the addition or no addition of a probiotic inoculant. After 70 days of ensiling, the silage was incubated for 48 h using the in vitro batch culture technique. Crude protein and non-fiber carbohydrates in the silage increased (P ≤ 0.01) by 5.7 percent point (pp) and 9.6 pp, respectively, with pumpkin at 60% DM. The V4 region of the 16S rRNA gene was sequenced to profile pre-ensiled and ensiled archeal and bacterial communities. Silages containing carrot or pumpkin strongly influenced the microbial structure (PERMANOVA: R2 = 0.75; P < 0.001), despite the ensiled treatments being dominated by Lactobacillus spp., except for the control, which was dominated by Weissella and Pediococcus spp. (P < 0.01). Linear discriminant analysis indicated that carrot and pumpkin silages were responsible for the increased relative abundance of Lactobacillus and Acinetobacter spp. (log LDA score ≥ 2), respectively. After 48 h of incubation, carrot and pumpkin inclusion increased (P < 0.01) the in vitro DM digestibility by 22.5 and 31.3%, increased the total volatile fatty acids (VFAs) by 16 and 20.6% (P < 0.01), respectively, and showed a tendency (P = 0.07) to increase the gas production. Therefore, this study supports the use of carrot or pumpkin in sorghum silages to maximize feed digestibility and total VFA concentrations.

show abstract

Ensiling sorghum with unsalable pumpkin improves feed digestibility with minimal influence on the rumen microbial population using the rumen simulation technique

Cited by 4 publications

References 55 publications

Ensiled Mixed Vegetables Enriched Carbohydrate Metabolism in Heterofermentative Lactic Acid Bacteria

Ensiled Mixed Vegetables Enriched Carbohydrate Metabolism in Heterofermentative Lactic Acid Bacteria

Identification of Fungi in Flaxseed (L. usitatissimum L.) Using the ITS1 and ITS2 Intergenic Regions

Unsalable Vegetables Ensiled With Sorghum Promote Heterofermentative Lactic Acid Bacteria and Improve in vitro Rumen Fermentation

Contact Info

Product

Resources

About