Enzymatic Assay for Rapid Measurement of Antiretroviral Drug Levels

Abstract

Poor adherence to pre-exposure prophylaxis (PrEP) and antiretroviral therapy (ART) can lead to human immunodeficiency virus (HIV) acquisition and emergence of drug resistant infections, respectively. Measurement of antiviral drug levels provides objective adherence information that may help prevent adverse health outcomes. Gold standard drug-level measurement by liquid chromatography/mass spectrometry is centralized, heavily instrumented, and expensive and is thus unsuitable and unavailable for routine use in clinical settings. We developed the REverse TranscrIptase Chain Termination (RESTRICT) assay as a rapid and accessible measurement of drug levels indicative of long-term adherence to PrEP and ART. The assay uses designer single stranded DNA templates and intercalating fluorescent dyes to measure complementary DNA (cDNA) formation by reverse transcriptase in the presence of nucleotide reverse transcriptase inhibitor drugs. We optimized the RESTRICT assay using aqueous solutions of tenofovir diphosphate (TFV-DP), a metabolite that indicates long-term adherence to ART and PrEP, at concentrations over two orders of magnitude above and below the clinically relevant range. We used dilution in water as a simple sample preparation strategy to detect TFV-DP spiked into whole *

Pilot Evaluation of an Enzymatic Assay for Rapid Measurement of Antiretroviral Drug Concentrations

“…(30) We are investigating other user-friendly sample preparation to further decrease non-speci c RT inhibition and assay variation in blood. (31) While additional data is required to more rigorously compare RESTRICT and LC-MS/MS measurements, our ndings here and our previous work with spiked blood samples (22) provide preliminary evidence for the potential of the RESTRICT assay for rapid detection of antiretroviral drug concentrations in clinical settings.…”

“…The coe cient of variation of the RESTRICT assay with blood samples with undetectable TFV-DP (N = 11) was 13.5% compared to only 4% in buffer. (22) This variation in uorescence intensity for samples with undetectable TFV-DP arises because blood dilution decreases but does not completely eliminate non-speci c inhibition of HIV RT by blood matrix components such as hemoglobin and immunoglobulins. (30) We are investigating other user-friendly sample preparation to further decrease non-speci c RT inhibition and assay variation in blood.…”

“…We recently developed an enzymatic assay, termed REverSe TRanscrIptase Chain Termination (RESTRICT), for rapid measurement of HIV reverse transcriptase activity, as a proxy measure of intracellular TFV-DP concentrations. (22) RESTRICT infers TFV-DP levels in a blood samples based on the extent of DNA synthesis by recombinant HIV RT using DNA templates, primers, nucleotides, and intercalating dyes provided during the assay. Our initial results with RESTRICT showed that we can accurately distinguish TFV-DP concentrations spiked into blood corresponding to low and high PrEP adherence.…”

“…Our initial results with RESTRICT showed that we can accurately distinguish TFV-DP concentrations spiked into blood corresponding to low and high PrEP adherence. (22) In this study, we compared the RESTRICT assay with TFV-DP measurement by LC-MS/MS among a cohort of adults receiving oral PrEP in Seattle.…”

“…RESTRICT detects TFV-DP drug concentrations based on its mechanism of action on HIV RT. (22) template buffered to pH 8.0 using HCl (7647-01-0, Acros Organics, Fair Lawn, NJ). Custom-designed DNA templates were synthesized in silico (Integrated DNA Technologies, Coralville IA) and consisted of a 20-nucleotide primer binding site followed by a 180-nucleotide detection T-rich region consisting of TTCA repeats to increase the likelihood of chain termination by TFV-DP (TTCATTCATTCATTCATTCATTCATTCATTCATTCATTCATTCATTCATTCATTCATTCATTCATTCATTCATTCATTCATTCATTCATTCATTCATTCATTCATTCATTCATT RT was obtained through the NIH AIDS Reagent Program, Division of AIDS, NIAID, NIH: HIV-1 RT Catalog #3555 from Dr. Stuart Le Grice and Dr. Jennifer T.…”