Enzymatic Synthesis of Rhamnose Containing Chemicals by Reverse Hydrolysis

Abstract

Rhamnose containing chemicals (RCCs) are widely occurred in plants and bacteria and are known to possess important bioactivities. However, few of them were available using the enzymatic synthesis method because of the scarcity of the α-L-rhamnosidases with wide acceptor specificity. In this work, an α-L-rhamnosidase from Alternaria sp. L1 was expressed in Pichia pastroris strain GS115. The recombinant enzyme was purified and used to synthesize novel RCCs through reverse hydrolysis in the presence of rhamnose as donor and mannitol, fructose or esculin as acceptors. The effects of initial substrate concentrations, reaction time, and temperature on RCC yields were investigated in detail when using mannitol as the acceptor. The mannitol derivative achieved a maximal yield of 36.1% by incubation of the enzyme with 0.4 M L-rhamnose and 0.2 M mannitol in pH 6.5 buffers at 55°C for 48 h. In identical conditions except for the initial acceptor concentrations, the maximal yields of fructose and esculin derivatives reached 11.9% and 17.9% respectively. The structures of the three derivatives were identified to be α-L-rhamnopyranosyl-(1→6')-D-mannitol, α-L-rhamnopyranosyl-(1→1')-β-D-fructopyranose, and 6,7-dihydroxycoumarin α-L-rhamnopyranosyl-(1→6')-β-D-glucopyranoside by ESI-MS and NMR spectroscopy. The high glycosylation efficiency as well as the broad acceptor specificity of this enzyme makes it a powerful tool for the synthesis of novel rhamnosyl glycosides.

Site-directed mutagenesis of α-l-rhamnosidase from Alternaria sp. L1 to enhance synthesis yield of reverse hydrolysis based on rational design

“…Mutations were verified by DNA sequencing (BoShang Co., Jinan, China). Recombinant wild-type (WT) and mutant RhaL1 were expressed and purified from Pichia pastoris GS115 as previously described (Lu et al 2015). The protein concentrations of WT and mutants were determined using BCA protein assay kit (Cwbiotech Co., Beijing, China).…”

“…TCCATGCGCGTGGCTGATTCGCGCGTCGTT a The mutated bases are underlined and high-performance liquid chromatographic system (HPLC) according to a previously reported method (Lu et al 2015). Briefly, TLC analysis was conducted using n-butanol/ ethanol/water (5:3:2, v/v/v) as the mobile phase.…”

“…It is a biotechnologically important enzyme in food industry and in the preparation of drugs and drug precursors (de Araujo et al 2013;Yadav et al 2010;You et al 2010). Meanwhile, some α-L-rhamnosidases can catalyze the synthesis of rhamnose-containing chemicals (RCCs) by reverse hydrolysis with the L-rhamnose as a donor (De Winter et al 2013;Lu et al 2015;Martearena et al 2008), suggesting that these enzymes would be attractive for synthesizing rare rhamnosylated compounds for chemical and pharmaceutical applications. Despite their industrial importance, few attempts have been made using protein engineering method to understand the catalytic mechanism for optimizing the catalytic efficiency of the existing rhamnosidases.…”

“…Therefore, reverse hydrolysis has been considered as an economically feasible approach for industrial applications (Julio and Andrew 2007). Several glycosidases including α-rhamnosidase (Lu et al 2015;Martearena et al 2008), β-glucosidase (Vic et al 1997), β-galactosidase (Majumder et al 2008;Wei et al 2013), α-mannosidase (Maitin et al 2004;Singh et al 2000), and endo-α-N-acetylgalactosaminidase (Ashida et al 2010) have been used for glycoside synthesis through reverse hydrolysis reaction. It has been experimentally proved that the transglycosylation efficiency could be improved by mutagenesis of the glycosidases, and the sitedirected mutagenesis based on rational protein design is regarded as the common strategy to improve the catalytic properties in glycosidases on the basis of the solved homological 3D structures (Choi et al 2008;Hansson et al 2001;Hinz et al 2006;Lundemo et al 2013;Pollet et al 2010;Sun et al 2014;Zeuner et al 2014).…”

“…L1 (CGMCC No. 3688) with high biotechnological potential in the biosynthesis of RCCs (Lu et al 2015). In this report, in order to obtain more efficient enzyme for RCCs synthesis, 12 mutants (D252N, D257N, D264N, W261Y, W261A, Y302F, Y316F, W369Y, E530D, R548A, H553A, and W555A) were generated by site-directed mutagenesis based on the following two criteria: (1) the amino acid residues selected for mutagenesis are in the vicinity of the active site, (2) the amino acid residues selected for mutagenesis could form direct or solventmediated hydrogen bonds with rhamnose, or could form the hydrophobic pocket in the active site cavity.…”