Epidemiology, Environmental Risks, Virulence, and Resistance Determinants of Klebsiella pneumoniae From Dairy Cows in Hubei, China

Abstract

Klebsiella pneumoniae (K. pneumoniae) is an opportunistic pathogen, which causes serious infections in humans and animals. To investigate the antimicrobial resistance pattern and virulence profile of K. pneumoniae, a total of 887 samples were collected from both the healthy and mastitis cows and the bedding, feed, feces, air, drinking water, spraying water, washing water, and milk cup swabs from five dairy farms in Hubei, China, during 2019 and 2020. K. pneumoniae was isolated and identified using PCR of the khe and 16S rDNA sequencing. A genotypic characterization was performed for K. pneumoniae isolates using wzi typing and multilocus sequence typing (MLST). Antimicrobial resistances were confirmed using broth microdilution against 17 antimicrobial agents and resistance and virulence genes were determined by PCR. The prevalence of K. pneumoniae was 26.94% (239/887) distributed in 101 wzi allele types (199/239, 83.26%) and 100 sequence types (STs) (209/239, 87.45%), including 5 new wzi allele type and 25 new STs. Phylogenetic analysis showed that K. pneumoniae isolated from milk, nipple swab, feed, and feces is classified in the same clone complex. By comparing with the PubMLST database, at least 67 STs have the risk of spreading in different species and regions. Interestingly, 60 STs have been isolated from humans. The isolates were highly sensitive to meropenem and colistin, but resistant to ampicillin (100%), sulfisoxazole (94.56%), cephalothin (47.28%), streptomycin (30.13%), and so on. Noteworthy, multidrug-resistant (MDR) rate was found to be 43.93% in this study. By PCR, 30 of 68 antimicrobial resistance (AMR) genes were identified; the prevalence rate of blaTEM, blaSHV, strA, strB, aadA1, and aac(6′)-Ib-cr was more than 50%. Eleven CTX-M-producing K. pneumoniae were found. The detection rate of fimH, mrkD, uge, wabG, entB, iutA, iroN, and ureA was over 85%. This study reinforces the epidemiological importance of K. pneumoniae in food-producing animals in Hubei. The emergence and spread of environmental MDR K. pneumoniae may pose a potential threat to food safety and public health.

Antimicrobial resistance and molecular characterization of Klebsiella species causing bovine mastitis in Nghe An province, Vietnam

“…These drugs have been widely used in farms for a long time to deal with clinical mastitis, which may be why resistance to these antimicrobials is high. Fifty-two percent of isolates resistant to STR in the current study is higher in other countries like Canada with 38% [ 32 ], and China with 30.1% [ 28 ]. Like LIN, STR was never used by these farms before, but the resistance rate was still very high, even higher than in other countries close to Vietnam; it is potentially because this pathogen entered farms through bedding materials purchased and needs further studies to conclude.…”

“…totally resistant to LIN and SUX, and AMP, resistant to LIN, was surprised as this antimicrobial has not been used by the farm, especially for treating mastitis cases; thus, a resistant gene related to this antimicrobial was not tested. Resistance to AMP was supported by similar studies in China [ 28 ] with 100% resistance, in Pakistan with 98% resistance to LIN, 86% AMP, and 99% SUX to mastitis pathogens [ 29 ]. Resistance toward AMP was used to predict the resistance to AMO [ 30 ]; thus, our AMO resistance was found to be high (56%) together with AMP, especially when compared with similar findings in China with 23.5% [ 31 ].…”

“…Our study revealed that 96% of isolates were MDR ( Table 5 ). In same purpose studies in China [ 34 , 31 , 28 ] reported that 6.1% (4/66), 19.1%, and 43.9% Klebsiella spp. isolated from mastitis was MDR.…”

Antibiograms, multidrug resistance, and milk-related parameters of bacteria isolated from milk of dairy cattle in Phatthalung, Thailand

“…[ 44 ], Staphylococcus aureus [ 61 ], E. coli [ 12 ], and Klebsiella spp. [ 62 ]. Our data showed high ABR in Klebsiella spp., Enterobacter spp., and CNSt.…”

Molecular Epidemiology and Antimicrobial Resistance of Outbreaks of Klebsiella pneumoniae Clinical Mastitis in Chinese Dairy Farms

“…Further identification and confirmation of the isolates were carried out by PCR of khe (GenBank accession no. CP035202.1 ) and 16S rRNA genes ( 26 , 40 ). The 16S rRNA genes of the isolates were amplified using the 16S universal primers 27F (5′- AGAGTTTGATCCTGGCTCAG -3′) and 1525R (5′- AAGGAGGTGATCCAGCCGCA -3′).…”