Epigenetic therapy of novel tumour suppressor ZAR1 and its cancer biomarker function

Abstract

BackgroundCancer still is one of the leading causes of death and its death toll is predicted to rise further. We identified earlier the potential tumour suppressor zygote arrest 1 (ZAR1) to play a role in lung carcinogenesis through its epigenetic inactivation.ResultsWe are the first to report that ZAR1 is epigenetically inactivated not only in lung cancer but also across cancer types, and ZAR1 methylation occurs across its complete CpG island. ZAR1 hypermethylation significantly correlates with its expression reduction in cancers. We are also the first to report that ZAR1 methylation and expression reduction are of clinical importance as a prognostic marker for lung cancer and kidney cancer. We further established that the carboxy (C)-terminally present zinc-finger of ZAR1 is relevant for its tumour suppression function and its protein partner binding associated with the mRNA/ribosomal network. Global gene expression profiling supported ZAR1's role in cell cycle arrest and p53 signalling pathway, and we could show that ZAR1 growth suppression was in part p53 dependent. Using the CRISPR-dCas9 tools, we were able to prove that epigenetic editing and reactivation of ZAR1 is possible in cancer cell lines.ConclusionZAR1 is a novel cancer biomarker for lung and kidney, which is epigenetically silenced in various cancers by DNA hypermethylation. ZAR1 exerts its tumour suppressive function in part through p53 and through its zinc-finger domain. Epigenetic therapy can reactivate the ZAR1 tumour suppressor in cancer.

Simulating ComBat: how batch correction can lead to the systematic introduction of false positive results in DNA methylation microarray studies

“…The basis for our simulation were 758,289 mean and standard deviation values from probes on an EPIC array, based on data from 69 patients collected in our laboratory. 1 Based on this data, random numbers were generated from a normal distribution using the "rnorm" function with the "Mersenne-Twister" algorithm [24] to generate simulated methylation beta values for every CpG site with a mean and standard deviation corresponding to the natural CpG sites. 2 Data from our laboratory were not used in any further analyses.…”

“…In the last two decades, the field of epigenetics has opened up new perspectives on complex medical questions [1][2][3]. DNA methylation (DNAm) is assumed to be modulated both by heritable factors [4] and by environmental conditions [5,6].…”

Epigenetic Inactivation of the Tumor Suppressor IRX1 Occurs Frequently in Lung Adenocarcinoma and Its Silencing Is Associated with Impaired Prognosis

“…IRX1 RNA guides for promotor reporter assay are #1, #3 CGCGACCGGCCTCCATC (−166), #5 TTGCCGGTCTGGCGGCGGCGC (-1201), and #6 GAGAAGAGGGACGCGGGACT (positioned -1242). p300 (pcDNA-dCas9-p300 Core, Addgene, Watertown, USA) was used as epigenetic modifier upon co-transfection in HeLa cells [64].…”

Regulation of processing bodies: From viruses to cancer epigenetic machinery

“…Zar1 was first observed in mice during oocyte to embryo transition, and Zar1 double knockout mice are infertile (X. Wu et al, 2003). In the context of cancer, it is a tumor suppressor that is found to be strongly hypermethylated in lung and kidney cancer and serves as an excellent diagnostic marker (Deutschmeyer et al, 2019). Here, the authors showed that ZAR1 expression correlated with TP53 (tumor protein p53) signaling pathway and G2M cell cycle checkpoint, which was a zinc finger motif‐dependent.…”

“…In corroboration with this study, Richter et al (2017) showed that ZAR1 is hypermethylated in primary lung cancer samples (22% small‐cell lung carcinoma and 76% non‐small‐cell lung carcinoma) whereas normal lung tissues were hypermethylated at only 11% (Figure 3; Table 2). A study also showed using the CRISPR‐CAS9 system that Zar1 can be edited and reactivated (Deutschmeyer et al, 2019). This study implies the therapeutic role of ZAR1.…”