Epitope Mapping of Aleutian Mink Disease Parvovirus Virion Protein VP1 and 2

Abstract

Six overlapping fragments of the Aleutian Mink Disease parvoVirus (AMDV) virion protein VP1 and 2 (VP1/2) gene were inserted into the expression vector pMAL-c2. Four of the clones carried large overlapping fragments covering the entire VP1/2 gene. The remaining two clones covered specifically chosen regions within the VP1/2 gene. Using a Western blotting detection system, sera from AMDV-infected mink were tested against the recombinant polypeptides. These studies showed reactions primarily directed against the two AMDV polypeptides ranging from amino acids 297 to 518. Weaker reactions against other regions of the VP1/2 were also observed. The small fusion protein designed to cover the presumed AMDV VP1/2 loop 4 was purified by affinity chromatography and used to develop solid-phase immunoassays. Twelve small synthetic peptides were constructed and used as inhibitors. A peptide covering amino acids S428 to T448 was shown to block the reactivity of a pool of positive mink sera, indicating the presence of one dominant linear epitope.

Comparative molecular analysis of strains of the Aleutian Disease Virus isolated from farmed and wild mink

“…Using the Immune Epitope Database and Analysis Resource (IEDB) (http://www.iedb.org/) and a study by Costello [17], two epitope regions were distinguished in the analysed sequence (Tab. 3): the first, considered by Costello to be dominant, in the S428-T448 region of the amino acid sequence, and the second in the K455-H471 region.…”

“…A fragment of the VP2 sequence was amplified using the forward primer 5'TCTAGATTGGGCCTACCTCCTCTCTG3' and the reverse primer 5'ATACAGGACCAACGTTGTCT3', according to Costello et al [17]. The reactions (25 μL total volume) contained 2 μl DNA and 1.5 U Taq polymerase (AmpliTaq Gold 360 DNA Polymerase, Applied Biosystems) in the manufacturer's buffer, adjusted to a final concentration of 2 mM MgCl2, 0.8 mM of each dNTP and 0.8mM of each primer.…”

“…Assembly, alignment and comparison of nucleotide and amino acid sequences were performed using MEGA 6 software. Epitope regions were identified on the basis of data from the Immune Epitope Database and Analysis Resource (IEDB) (http:// www.iedb.org/) and a study by Costello [17]. A phylogenetic tree was prepared by MEGA 6 using the maximum likelihood method with 1,000 bootstrap replicates.…”

Identification of Aleutian Mink Disease Parvovirus Capsid Sequences Mediating Antibody-Dependent Enhancement of Infection, Virus Neutralization, and Immune Complex Formation

“…When VP2 from the ADV-G isolate is expressed in either recombinant vaccinia viruses (24) or baculoviruses (23,63), the proteins assemble into empty capsids. Recent work with prokaryotic expression vectors has localized immunodominant targets for the antibody response to specific regions of the VP2 capsid protein (16,28). The most immunoreactive region spans VP2 residues 429 to 524 (VP2:429-524) (16,28).…”

Addition of Six-His-Tagged Peptide to the C Terminus of Adeno-Associated Virus VP3 Does Not Affect Viral Tropism or Production

“…Each of them are produced by alternative splicing of the transcript generated from the p40 promoter by use of alternative start codons at nucleotide position 2203 for VP1, 2614 for VP2, and 2809 for VP3 (15,31,32). The C-terminal region sequences that are common to all three capsid proteins promote folding of the C-terminal region of the polypeptide into a ␤-barrel structure, which is present in several viruses, including parvovirus B19 and porcine parvovirus (1,5,7,18,19,26). The relative abundance of VP3 within the capsid is considerably higher (90%), than that of VP1 (5%) and VP2 (5%) (24,29,32).…”