Establishment of a Colony of Phlebotomus argentipes under Laboratory Conditions and Morphometric Variation between Wild-Caught and Laboratory-Reared Populations

Abstract

The field-based studies on sand flies are not adequate to uncover information required for the control of the leishmaniasis through reduction of vector populations. Therefore, establishment and maintenance of laboratory colonies of sand flies is an essential step in leishmaniasis research. In the current study, a colony of P. argentipes was established from wild-caught sand flies following standard procedures from the published literature. Morphological measurements of laboratory-reared and wild-caught individual sand flies were compared to assess the difference between two groups. The colony was successfully established under confined laboratory conditions. The comparison of morphometric parameters revealed that the laboratory-reared sand flies are significantly larger than those caught from wild, suggesting a possibility of increased fitness of sand flies under favorable environmental conditions which may cause higher prevalence in the disease. The current study reports the first successful attempt in colonizing sand flies under laboratory conditions. However, the colony data suggest that the conditions extracted from the published literature need to be optimized to suit local settings in order to achieve maximum population sizes within the available amount of resources.

Aspects of the biology of <em>Phlebotomus argentipes</em> (Diptera: Psychodidae) in Kurunegala district

“…Before pupation, fourth instar larvae empty their guts thus making them opaquer and by this time they had not been fed. However, Wijerathna et al (2020) showed that the larval durations of the first, second, third and fourth instars were 5-7, 4-5, 3-4, and 6-9 days respectively while the pupal duration was 8-10 days. The duration of the life cycle, egg hatching, and Biology of P. argentipes 123 larval development in the current study show a contrasting result with that of the study conducted by Wijerathna et al (2020).…”

“…However, Wijerathna et al (2020) showed that the larval durations of the first, second, third and fourth instars were 5-7, 4-5, 3-4, and 6-9 days respectively while the pupal duration was 8-10 days. The duration of the life cycle, egg hatching, and Biology of P. argentipes 123 larval development in the current study show a contrasting result with that of the study conducted by Wijerathna et al (2020). This may be because the current study tried to concentrate more on giving natural conditions in the laboratory than using artificial conditions.…”

“…Each gravid female laid an average of 15.8 eggs, 10-13 days after the post-blood meal, and they were very tiny about 0.4 mm in length and about 0.2 mm wide elongated oval-shaped brown-coloured eggs (Figure 1). However, according to the study conducted under strict laboratory conditions by Wijerathna et al (2020), the life cycle of P. argentipes is completed within 36-50 days with an average oviposition rate of 10.03 eggs per female and the eggs are laid 6 days after the post blood meal. Bestowing to the current study, after 12-16 days first instar larvae emerged, and they were white-coloured worm-like very tiny (< 1.0 mm) microscopic organisms (Figure 2a).…”

“…Furthermore, the percentage of eggs hatched was 62.52% and the adult emergence was 52.32%. According to Wijerathna et al (2020), the hatching rate was 76.57% and the pupation success was 46.10%. This distinct result may be due to the changes in the humidity and temperature levels maintained in the two studies.…”

Detection of Leishmania donovani DNA within Field-Caught Phlebotomine Sand Flies (Diptera: Psychodidae) in Three Cutaneous Leishmaniasis Endemic Foci of Kurunegala District, Sri Lanka

“…erefore, all the existing data suggest that P. argentipes is potentially competent vector for the transmission of L. donovani. e next steps should be the confirmation of luxuriant growth of the parasite within the CTTTTGATAATCGATATTTGTTTTAAACTGGGTTAGTTCGGCTGGATACACg t t g g t t g g CTTTTGATAATCGATATTTGTTTTAAACTGGGTTAGTTCGGCTGGATGCACGTTGGTTGG a t t g g a t t t g g a t t g g a t t t g g a t t t t a t a c g g g g t t g g g g g c t t g a t t t g g g t sand fly stomdeal valve in the midgut and experimental transmission by vectors under laboratory conditions [42,46]. e use of retrospective data to generate mathematical modeling-based proof of this species being essential for the maintenance of the parasitic transmission cycle with or without the involvement of other vectors is also a necessity.…”