Establishment of a Novel Multiplex PCR Assay and Detection of Toxigenic Strains of the Species in the Bacillus cereus Group

Abstract

Five different enterotoxins and one emetic toxin of Bacillus cereus have been characterized. To amplify all of the enterotoxin and emetic-specific sequences of the species in the B. cereus group, a multiplex PCR with 12 primer pairs was established. In developing the assay method, a common terminal sequence at the 3' ends of all primers was chosen and a hot start Taq polymerase was used to overcome primer dimer formation. The assay was successfully applied to analyze the toxigenic potential of 162 food-poisoning and food-related strains. Results showed that there were 10 toxigenic patterns for all the test strains. All of the B. cereus strains carried at least one toxin gene. More than 70% of Bacillus mycoides strains carried no known toxin genes. The toxin profiles and toxin genes of B. mycoides strains were significantly different from B. cereus strains (P < 0.05), although the two species were closely related. The results suggest that many B. mycoides strains might be less prone to cause food poisoning. They also indicate the importance of detecting the toxin genes together with the detection of the species in the B. cereus group.

Determination of Enterotoxigenic Gene Profiles of Bacillus cereus Strains Isolated from Dairy Desserts by Multiplex PCR

“…The results showed that 30% (6/20) of B. cereus isolates contained three enterotoxic HBL complex encoding genes hblA, hblC and hblD, whereas 70% (14/20) had no hbl genes. All three enterotoxic NHE complex encoding genes nheA, nheB and nheC were detected in 40% of isolates (8/20), whereas two nhe genes (nheA and nheB) were found in 45% (9/20) of the isolates [39] hblD F hblD R AGGTCAACAGGCAACGATTC CGAGAGTCCACCAACAACAG 205 [39] hblA F hblA R ATTAATACAGGGGATGGAGAAACTT TGATCCTAATACTTCTTCTAGACGCTT 237 [40] nheA F nheA R GAGGGGCAAACAGAAGTGAA TGCGAACTTTTGATGATTCG 186 [39] nheB F nheB R CCGCTTCTGCAAAATCAAAT TGCGCAGTTGTAACTTGTCC 281 [39] nheC F nheC R ACATCCTTTTGCAGCAGAAC CCACCAGCAATGACCATATC 618 [41] cytK1 F cytK1 R AACAGATATCGGTCAAAATGC CGTGCATCTGTTTCATGAGG 623 [42] and one nhe gene (two nheA and one nheB) was found in 15% (3/20) of the isolates. The ctyK1 gene was not detected in any sample (Fig.…”

Detection of coding genes for enterotoxins in Bacillus cereus by PCR and their products by BCET-RPLA and ELISA Assay

“…Primer sequences used for the detection of the various genes were specifi ed in the work of Yang et al (2005) - Table II. Two primer pairs were used to detect the same region of the cytK gene, for there was variation in the sequences (cytK1 and cytK2) of the region among diff erent strains.…”

“…The diarrhoeal type enterotoxin is formed by heat-labile proteins which can be inactivated by heat treatment at 56 °C for 5-30 min (Murray et al, 1999). Bacillus cereus produces the following diff erent diarrhoeal ente ro to xins: protein complex (haemolytic HBL and non-haemolytic NHE enterotoxins), enterotoxic proteins (enterotoxin T), cytotoxin K and enterotoxin FM (Yang et al, 2005;Lindbäck et al, 2004). Sergeev et al (2006) classifi ed enterotoxin FM as a haemolytic enterotoxin and as cytotoxin.…”

“…These are encoded by genes hblC, hblD and hblA (Beecher et al, 1995). All three components are required for toxic activity (Yang et al, 2005). NHE consists of three proteins: NheA, NheB and NheC which are encoded by genes nheA, nheB and nheC, respectively.…”

“…NHE consists of three proteins: NheA, NheB and NheC which are encoded by genes nheA, nheB and nheC, respectively. All three components are also needed for maximum cytotoxic activity (Lindbäck et al, 2004;Yang et al, 2005). The nucleotide sequence denoted bceT has been reported to encode a single component toxin T (BceT, 41-kDa protein) which exhibits Vero cell cytotoxicity and has also been attributed to having a role in the diarrheal syndrome (Agata et al, 1995a).…”