Establishment of a real-time RT-PCR for the determination of absolute amounts of IGF-I and IGF-II gene expression in liver and extrahepatic sites of the tilapia

Caelers, Antje; Berishvili, Giorgi; Meli, Marina L.; Eppler, Elisabeth; Reinecke, Manfred

doi:10.1016/j.ygcen.2004.03.006

Cited by 91 publications

(49 citation statements)

References 29 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Prior to analysis, amplification efficiencies of all qPCR assays were validated by plotting of C T values of the dilution series of the DNA template against the logarithms of the dilution factors. Comparison of the slopes confirmed that the efficiencies of the compared assays were very similar [38]. Statistical analysis was performed on the DC T values of each sample, and the data distribution is presented as a scatter plot of these values.…”

Section: Methodsmentioning

confidence: 63%

Egg size-dependent expression of growth hormone receptor accompanies compensatory growth in fish

2011

View full text Add to dashboard Cite

Large egg size usually boosts offspring survival, but mothers have to trade off egg size against egg number. Therefore, females often produce smaller eggs when environmental conditions for offspring are favourable, which is subsequently compensated for by accelerated juvenile growth. How this rapid growth is modulated on a molecular level is still unclear. As the somatotropic axis is a key regulator of early growth in vertebrates, we investigated the effect of egg size on three key genes belonging to this axis, at different ontogenetic stages in a mouthbrooding cichlid (Simochromis pleurospilus). The expression levels of one of them, the growth hormone receptor (GHR), were significantly higher in large than in small eggs, but remarkably, this pattern was reversed after hatching: young originating from small eggs had significantly higher GHR expression levels as yolk sac larvae and as juveniles. GHR expression in yolk sac larvae was positively correlated with juvenile growth rate and correspondingly fish originating from small eggs grew faster. This enabled them to catch up fully in size within eight weeks with conspecifics from larger eggs. This is the first evidence for a potential link between egg size, an important maternal effect, and offspring gene expression, which mediates an adaptive adjustment in a relevant hormonal axis.

show abstract

Section: Methodsmentioning

confidence: 63%

Egg size-dependent expression of growth hormone receptor accompanies compensatory growth in fish

2011

View full text Add to dashboard Cite

show abstract

“…Postnatally elevated levels of IGF-II fail to rescue the dwarfism of IGF-I-deficient mice (Moerth et al 2007), although species-specific differences appear to be important in IGF-II expression and function. Thus, transcripts of IGF-II decrease quickly during the postnatal development of mice and rats (Rotwein 1991), but substantial amounts are found later in life in humans and in a wide range of fish species, including common carp (Vong et al 2003), rainbow trout (Chauvigné et al 2003), Nile tilapia (Caelers et al 2004), channel catfish (Peterson et al 2004), and gilthead sea bream (Duguay et al 1996). Of note, a relative high expression of IGF-II is retained in extra-hepatic tissues of most fish species, and compensatory increases of muscle IGF-II have been documented in fast-growing juveniles of gilthead sea bream when they were fed practical diets with increased amounts of feed-borne contaminants (Benedito-Palos et al 2007).…”

Section: Discussionmentioning

confidence: 99%

Co-expression of IGFs and GH receptors (GHRs) in gilthead sea bream (Sparus aurata L.): sequence analysis of the GHR-flanking region

Saera-Vila¹,

Calduch-Giner²,

Pérez‐Sánchez

2007

Journal of Endocrinology

View full text Add to dashboard Cite

The tissue-specific expression of IGFs and GH receptors (GHRs) was analyzed in gilthead sea bream (Sparus aurata L.) as an attempt to understand the functional partitioning of duplicated GHRs on the regulation of fish growth by season and aging. Gene transcripts were measured in liver, muscle, and adipose tissue by means of quantitative real-time PCR assays. In juvenile fish, concurrent increases in circulating levels of GH and IGF-I and hepatic mRNA levels of IGF-I and GHR-I were evidenced with the summer growth spurt. Conversely, muscle and adipose tissue expression of GHR-I and IGF-II were significantly upregulated by overwintering. The aging decrease of growth rates was accompanied by a reduced activity of the liver GH/IGF axis, and parallel increases in muscle IGF expression would be dictated at the local tissue level by the enhanced expression of GHR-I. Extra-hepatic expression of IGFs and GHR-II did not correlate seasonally in juvenile fish, and nonsignificant effects of aging were found on the summer expression of GHR-II in any analyzed tissue. One transcription start site was identified by RLM-RACE in GHR-I and GHR-II. Sequence analyses indicated that both genes have TATA-less promoters containing consensus initiator sequences and downstream promoter elements surrounding the transcription start site. Conserved CCAAT-boxes and GC-rich regions were retrieved in the GHR-I promoter, whereas stress-and redoxsequence elements (cAMP-responsive element-binding protein, activator proteins; AP-1, and AP-4) were characteristic features of GHR-II. All this supports the functional partitioning of fish GHRs regardless of fish species differences.

show abstract

“…Design of primers and probes for real-time PCR Based on the mRNA sequences of O. mossambicus IGF-I (Reinecke et al 1997), O. niloticus GH (Ber & Daniel 1992), and b-actin (Hwang et al 2003), specific primers and probes for real-time PCR were created as already described (Caelers et al 2004(Caelers et al , 2005 for IGF-I (sense TCTGTGGAGAGCGAGGC-TTT, antisense CACGTGACCGCCTTGCA, probe ATTT-CAATAAACCAACAGGCTATGGCCCCA), GH (sense TCGACAAACACGAGACGCA, antisense CCCAGGACT-CAACCAGTCCA, probe CGCAGCTCGGTCCTGAAGC-TG), and b-actin as a house-keeping gene (sense GC CCCACCTGAGCGTAAATA, antisense AAAGGTGGA-CAGGAGGCCA, probe TCCGTCTGGATCGGAGGCTT-CATC). Using this method, new primers and probe (sense CAAGTGGTGGAGGAGGAAGATC, antisense CTCAG-CACCCTGGAGCAG, probe CTGATCAGGTGCTCCTC) were designed for ERa based on the O. niloticus ERa sequence (Chang et al 1999) with Primer Express software version 1.5 (PE Biosystems, Foster City, CA, USA).…”

Section: Ria For Igf-imentioning

confidence: 99%

“…Data were normalized to b-actin as the reference gene. Efficiency tests for b-actin and IGF-I assays (Caelers et al 2004) and ERa assay (data not shown) permitted the accurate use of the DDC T method. Relative changes induced by EE 2 feeding were calculated by the formula 2 KDDC T , with DDC T ZDC T (treated group) -DC T (untreated control), and DC T ZC T (target gene) -C T (reference gene).…”

Section: Relative Quantification Of Treatment Effects Using the Ddc Tmentioning

confidence: 99%

Ethinylestradiol differentially interferes with IGF-I in liver and extrahepatic sites during development of male and female bony fish

Shved

Berishvili

D'Cotta

et al. 2007

Journal of Endocrinology

Self Cite

View full text Add to dashboard Cite

Growth and sexual development are closely interlinked in fish; however, no reports exist on potential effects of estrogen on the GH/IGF-I-axis in developing fish. We investigate whether estrogen exposure during early development affects growth and the IGF-I system, both at the systemic and tissue level. Tilapia were fed from 10 to 40 days post fertilization (DPF) with 17a-ethinylestradiol (EE 2 ). At 50, 75, 90, and 165 DPF, length, weight, sex ratio, serum IGF-I (RIA), pituitary GH mRNA and IGF-I, and estrogen receptor a (ERa) mRNA in liver, gonads, brain, and gills (real-time PCR) were determined and the results correlated to those of in situ hybridization for IGF-I. Developmental exposure to EE 2 had persistent effects on sex ratio and growth. Serum IGF-I, hepatic IGF-I mRNA, and the number of IGF-I mRNA-containing hepatocytes were significantly decreased at 75 DPF, while liver ERa mRNA was significantly induced. At 75 DPF, a transient decline of IGF-I mRNA and a largely reduced number of IGF-I mRNA-containing neurons were observed in the female brain. In both sexes, pituitary GH mRNA was significantly suppressed. A transient downregulation of IGF-I mRNA occurred in ovaries (75 DPF) and testes (90 DPF). In agreement, in situ hybridization revealed less IGF-I mRNA signals in granulosa and germ cells. Our results show for the first time that developmental estrogen treatment impairs GH/IGF-I expression in fish, and that the effects persist. These long-lasting effects both seem to be exerted indirectly via inhibition of pituitary GH and directly by suppression of local IGF-I in organ-specific cells.

show abstract

Establishment of a real-time RT-PCR for the determination of absolute amounts of IGF-I and IGF-II gene expression in liver and extrahepatic sites of the tilapia

Cited by 91 publications

References 29 publications

Egg size-dependent expression of growth hormone receptor accompanies compensatory growth in fish

Egg size-dependent expression of growth hormone receptor accompanies compensatory growth in fish

Co-expression of IGFs and GH receptors (GHRs) in gilthead sea bream (Sparus aurata L.): sequence analysis of the GHR-flanking region

Ethinylestradiol differentially interferes with IGF-I in liver and extrahepatic sites during development of male and female bony fish

Contact Info

Product

Resources

About