Establishment of Bacterial Herbicide Degraders in a Rapid Sand Filter for Bioremediation of Phenoxypropionate-Polluted Groundwater

Abstract

In this study, we investigated the establishment of natural bacterial degraders in a sand filter treating groundwater contaminated with the phenoxypropionate herbicides (RS)-2-(4-chloro-2-methylphenoxy)propanoic acid (MCPP) and (RS)-2-(2,4-dichlorophenoxy)propanoic acid (DCPP) and the associated impurity/catabolite 4-chlorophenoxypropanoic acid (4-CPP). A pilot facility was set up in a contaminated landfill site. Anaerobic groundwater was pumped up and passed through an aeration basin and subsequently through a rapid sand filter, which is characterized by a short residence time of the water in the filter. For 3 months, the degradation of DCPP, MCPP, and 4-CPP in the sand filter increased to 15 to 30% of the inlet concentration. A significant selection for natural bacterial herbicide degraders also occurred in the sand filter. Using a most-probable-number (MPN) method, we found a steady increase in the number of culturable phenoxypropionate degraders, reaching approximately 5 ؋ 10 5 degraders per g sand by the end of the study. Using a quantitative PCR targeting the two phenoxypropionate degradation genes, rdpA and sdpA, encoding stereospecific dioxygenases, a parallel increase was observed, but with the gene copy numbers being about 2 to 3 log units higher than the MPN. In general, the sdpA gene was more abundant than the rdpA gene, and the establishment of a significant population of bacteria harboring sdpA occurred faster than the establishment of an rdpA gene-carrying population. The identities of the specific herbicide degraders in the sand filter were assessed by Illumina MiSeq sequencing of 16S rRNA genes from sand filter samples and from selected MPN plate wells. We propose a list of potential degrader bacteria involved in herbicide degradation, including representatives belonging to the Comamonadaceae and Sphingomonadales.G roundwater is a valuable resource that is used for drinking water in many countries all over the world. The quality of the water is vital to our health, and regulations have been made to control the concentration of contaminants and protect the groundwater (1). A major concern is leaching of pesticides mainly from agricultural areas but also from urban areas or from point sources (2). In the European Union, a legal threshold limit has been set at 0.1 g/liter for any given pesticide or 0.5 g/liter for a total concentration of mixed pesticides in drinking water (3).In Denmark, monitoring of the groundwater status has detected pesticides in almost 40% of the investigated wells, and the concentrations exceed the allowed threshold limit in 12% of the wells (4). Phenoxypropionate herbicides, including the compounds (RS)-2-(2,4-dichlorophenoxy)propanoic acid (known as DCPP or dichlorprop) and (RS)-2-(4-chloro-2-methylphenoxy)propanoic acid (known as MCPP or mecoprop), are among the pesticides frequently found in contaminated wells (4). The herbicides are, in particular, a problem in old landfill areas, from where they are leaching into the groundwater as a point source contamination (5). Phe...

Rapid mineralization of biogenic volatile organic compounds in temperate and Arctic soils

“…For each soil, triplicate DNA extractions were made from 0.25 g subsamples using the PowerLyzer PowerSoil DNA Isolation Kit (MoBio, Carlsbad, California). Total bacterial biomass was quantified as 16s gene copies by qPCR targeting the 16S rRNA sequence using a forward primer 341F (5 -CCTACGGGAGGCAGCAG-3 ) and reverse primer 518R (5 -ATTACCGCGGCTGCTGG-3 ) and a 1 µL DNA template, as previously described (Feld et al, 2016). Total fungal biomass was determined as ITS2 gene copies by targeting the fungal ITS2 nuclear ribosomal DNA region using forward primer gITS7 (GTGARTCATCGARTCTTTG) and reverse primer ITS4 (TCCTCCGCTTATTGATATGC) as previously described (Christiansen et al, 2017).…”

“…In addition to the uptake from the atmosphere, the very fast mineralization rates are likely important in shaping the net BVOC emissions from soil. The net BVOC release from the soil to the atmosphere is in general low compared to the plant emissions (Peñuelas et al, 2014), but emissions may represent a minor portion of the amount that was excreted by soil microbes (Insam and Seewald, 2010;Garbeva et al, 2014) or by roots (Lin et al, 2007;Delory et al, 2016), produced, for example, with the purpose of communication (Garbeva et al, 2014;Delory et al, 2016). It is thus possible that BVOCs are a significant source of carbon to soil microbes and hence that BVOC formation and degradation may be important but little-recognized parts of the internal carbon cycle in soil.…”

“…Non-methane biogenic volatile organic compounds (BVOCs) are produced by all life forms, with plants being the most important contributors to the atmospheric concentrations of BVOCs and also the most studied group of BVOC emitters (Laothawornkitkul et al, 2009;Peñuelas et al, 2014). The production of BVOCs in soil (McNeal and Herbert, 2009;Ramirez et al, 2010) and by isolated soil microorganisms (Insam and Seewald, 2010;Garbeva et al, 2014) has been shown as well.…”

Rapid mineralization of biogenic volatile organic compounds in temperate and Arctic soils

“…Total bacterial biomass was quantified as 16s gene copies by qPCR targeting the 16S rRNA sequence using forward primer 341F (5´-CCTACGGGAGGCAGCAG-3´) and reverse primer 518R (5´-ATTACCGCGGCTGCTGG-3´) and 1 µL DNA template, as previously described (Feld et al, 2016 forward primer gITS7 (GTGARTCATCGARTCTTTG) and reverse primer ITS4 (TCCTCCGCTTATTGATATGC) as previously described (Christiansen et al, 2017). All qPCR was run in technical triplicates.…”

Análisis de la microbiota de la vid de distintas regiones vitivinícolas y sus propiedades promotoras del crecimiento vegetal

“…Este riego impactó en el volumen radicular de las vides, y causó cambios drásticos en los patrones de distribución microbiológica (Sandor & Homburg, 2017 (Hansen et al, 2012;Gobbi et al, 2018). La construcción de bibliotecas se realizó mediante doble PCR, y de acuerdo a protocolos descriptos en Feld et al, (2016) y Gobbi et al, (2018) Las lecturas se procesaron de acuerdo a la plataforma UPARSE utilizando USEARCH V.10.0.240_i86linux64 (Edgar, 2013) con las siguientes diferencias: (i) el paso de filtrado de calidad y corte de longitud de las lecturas fue reemplazado con una estrategia alternativa de filtrado de calidad (usearch -fastq_filter -maxee 1.0) (Edgar & Flyvbjerg, 2015) Para el análisis del perfil microbiano se comparó la composición alfa mediante un análisis de varianza ANOVA (Hammer et al, 2001). Para la comparación de las muestras de a pares se utilizó el Tukey Pairwise (Olleveant, 1999).…”