Evaluation of brinjal germplasm against root-knot nematode, Meloidogyne incognita

Gawade, Bharat H.; Chaturvedi, Shikha; Khan, Zakaullah; Pandey, Chithra Devi; Gangopadhyay, K.K.; Dubey, S. C.; Chalam, V. Celia

doi:10.1007/s42360-022-00461-4

Cited by 6 publications

(3 citation statements)

References 13 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Salicylic acid has been known to be phytotoxic to many crops when used at high concentrations. Enhancing effects of exogenous SA application on plant growth have been reported in several crops (Gharib 2006;Gawade and Sirohi 2011;Khandaker et al 2011). Therefore, our findings can add cassava to the list of such crops.…”

Section: Discussionsupporting

confidence: 67%

Journal of Plant Protection Research

Saengchan,

Phansak,

Thanh

et al. 2021

View full text Add to dashboard Cite

The efficiency of a formulated salicylic acid (Zacha 11, 500 mg • l -1 ) and a Bacillus bioproduct (JN2-007, 1 × 10 7 cfu • ml -1 ) in controlling cassava root rot disease and enhancing growth was evaluated. The results revealed that cassava stalk soaking and foliage spraying with Zacha 11 formulation or Bacillus subtilis bioproduct could increase cassava growth at 60 days after planting under greenhouse conditions. Zacha 11 gave the tallest stem height (11.67 cm), the longest root length (18.91 cm) and the greatest number of roots (49.50). Fusarium root rot severity indices of all treated treatments were reduced, and were significantly lower than that of the water control. Plants treated with Zacha 11 and JN2-007 had disease severity reduction of 53.33 and 48.33%, respectively. Furthermore, all treatments increased the endogenous salicylic acid (SA) content in cassava plants at 24 inoculation with significant differences when compared to the untreated samples. The efficacy of Zacha 11 and JN2-007 was evaluated at two field locations, using two different cassava varieties, cv. Rayong 72 and CMR-89. The results showed that all elicitors could suppress root rot disease as well as bacterial leaf blight. Furthermore, the elicitors helped cassava plants cv. Rayong 72 and CMR-89 to increase tuber weight, yield and starch contents, compared to the water control. Thus, it is possible that these formulations could be effective in controlling diseases and increasing cassava productivity.

show abstract

Section: Discussionsupporting

confidence: 67%

Journal of Plant Protection Research

Saengchan,

Phansak,

Thanh

et al. 2021

View full text Add to dashboard Cite

show abstract

“…Manual picking requires a lot of energy and materials due to lack of time, lateness, and incorrect selection, which increases the price of fruits and vegetables and makes it unachievable [10].With the development of automation technology and artificial intelligence technology, the operation mode of fruit and vegetable picking has changed, and it has begun to develop from traditional manual picking to mechanical picking and automatic picking; the application has greatly improved the efficiency of agricultural production [11]. However, a single picking robot arm and manipulator cannot accurately identify the picking target and perform precise positioning during the fruit and vegetable picking process, so the picking efficiency needs to be improved, and the identification and positioning of the picking target determines the quality of fruit and vegetable picking [12]. Computer image technology adopts the principle of profiling and replaces human eyes and brains with machines to complete image acquisition and processing.…”

Section: Literature Reviewmentioning

confidence: 99%

Robot Structural Optimization Based on Computer Intelligent Image

Zhao¹

2022

Wireless Communications and Mobile Computing

View full text Add to dashboard Cite

In order to solve the problems of low degree of automation, difficult identification of picking objects, and large picking damage in traditional fruit and vegetable picking operations, the author proposes a robot structure optimization method based on computer intelligent images. This method introduces the computer imaging technology, examines the principle of imaging the computer imaging technology as the in-depth study of the computer imaging technology, completes the mechanical design of the selected robot, and optimizes all hardware models of choice robot. At the same time, the computer image acquisition system, image acquisition module, and execution module are designed; finally, the computer image information processing flow design of the picking robot is completed, and the simulation experiment of the picking robot is carried out. Experimental results show that in the experiments with 166, 142, and 165 tomato identification numbers, the identification accuracy rates were all over 96%. Conclusion. The picking robot based on computer images has a simple structure, high recognition accuracy of picking targets, less damage to the picking targets, high safety and stability, and great promotion value.

show abstract

“…The quality of DNA was checked and PCR amplification was carried using universal primers specific to Internal Transcribed Region (ITS) of nematodes (Forward primer 5ʹ TTGATTACGTCCCTGCCCTTT 3ʹ and reverse primer 5ʹ TTTCACTCGCCGTTACTAAGG 3ʹ) as described by Vrain et al [13]. PCR conditions and programme for amplification of ITS region were followed as per the method used by Gawade et al [14]. PCR product was subjected to 1.2% agarose gel electrophoresis and visualized under gel documentation system (G‐Box, Syngene).…”

Section: Methodsmentioning

confidence: 99%

Plant growth promotingBacillusspecies elicit defense againstMeloidogyne incognitainfecting tomato in polyhouse

Kamra,

Singh

et al. 2023

J Basic Microbiol

View full text Add to dashboard Cite

The effects of four nematicidal rhizobacterial isolates; Bacillus subtilis, Bacillus pumilus, Bacillus megaterium, and Bacillus cereus on infection and multiplication of root‐knot nematode, Meloidogyne incognita on tomato were compared with the application of a chemical nematicide, fluopyram 34.48% SC (Velum Prime). The bio‐efficacy trial conducted in pots preinoculated with the above isolates followed by M. incognita inoculation resulted in a significant reduction in percent root galling viz. 91.95 in B. subtilis, 84.21 in B. pumilus, 83.70 in B. megaterium, and 81.8 in B. cereus, at 75 days after inoculation (DAI). The reproduction factor of the nematode was the lowest (15.83) in B. subtilis, followed by B. pumilus (21.00), compared with 48.16 in control, with enhanced photosynthetic and transpiration rates. The mechanism of induced resistance was assessed using quantitative reverse‐transcription polymerase chain reaction (qRT‐PCR) for quantification of three key defense genes (PR‐1b, JERF3, and CAT) at 0,2,4,8 and16 days DAI. The defence genes, PR‐1b, JERF3, and CAT were expressed at 2.5–7.5‐folds in rhizobacterialtreated plants, but not in nematicide treatment. The defense enzymes viz., super oxide dismutase (SOD), polyphenol oxidase (PPO), peroxidase (PO), and phenylalanine ammonia lyase (PAL) when quantified (μmol/mg protein) showed an increase from 1.5 to 17.5 for SOD, 2.1 to 7.8 in PPO, 1.8 to 10.2 in PO, and 1.8 to 8.7 in PAL during 0 to 16 DAI, in rhizobacteria‐treated plants.

show abstract

Evaluation of brinjal germplasm against root-knot nematode, Meloidogyne incognita

Cited by 6 publications

References 13 publications

Journal of Plant Protection Research

Journal of Plant Protection Research

Robot Structural Optimization Based on Computer Intelligent Image

Plant growth promotingBacillusspecies elicit defense againstMeloidogyne incognitainfecting tomato in polyhouse

Contact Info

Product

Resources

About