Evaluation of candidate reference genes for RT-qPCR studies in three metabolism related tissues of mice after caloric restriction

Abstract

Reverse transcription quantitative-polymerase chain reaction (RT-qPCR) is a routine method for gene expression analysis, and reliable results depend on proper normalization by stable reference genes. Caloric restriction (CR) is a robust lifestyle intervention to slow aging and delay onset of age-associated diseases via inducing global changes in gene expression. Reliable normalization of RT-qPCR data becomes crucial in CR studies. In this study, the expression stability of 12 candidate reference genes were evaluated in inguinal white adipose tissue (iWAT), skeletal muscle (Sk.M) and liver of CR mice by using three algorithms, geNorm, NormFinder, and Bestkeeper. Our results showed β2m, Ppia and Hmbs as the most stable genes in iWAT, Sk.M and liver, respectively. Moreover, two reference genes were sufficient to normalize RT-qPCR data in each tissue and the suitable pair of reference genes was β2m-Hprt in iWAT, Ppia-Gusb in Sk.M and Hmbs-β2m in liver. By contrast, the least stable gene in iWAT or Sk.M was Gapdh, and in liver was Pgk1. Furthermore, the expression of Leptin and Ppar-γ were profiled in these tissues to validate the selected reference genes. Our data provided a basis for gene expression analysis in future CR studies.

Relative expression and regulation by short‐term fasting of lysophosphatidic acid receptors and autotaxin in white and brown adipose tissue depots

“…Taqman™ gene expression assays (Life Technologies, Burlington, ON, Canada) were used with PerfeCTA qPCR FastMix (Quanta Biosciences, Gaithersburg, MD, USA) to analyze expression of Lpar ( Lpar1 : Mm01346925_m1, Lpar2 : Mm00469562_m1, Lpar3 : Mm00469694_m1, Lpar4 : Mm02620784_s1, Lpar5 : Mm02621109_s1, Lpar6 : Mm00613058_s1). Atx : forward 5′‐GACCCTAAAGCCATTATTGCTAA‐3′; reverse 5′‐GGGAAGGTGCTGTTTCATGT‐3′, and beta‐actin ( Actb ) (forward 5′‐CCTGTGCTCACCGAGGC‐3′; reverse 5′‐GACCCCGTCTCTCCGGAGTCCATC‐3′) were analyzed using PerfeCTA SYBR®Green SuperMix (Quanta Biosciences), with cycling conditions of 95 °C for 5 min, followed by 40 cycles at 95 °C for 15 s, then 60 °C for 30 s. Gene expression levels were calculated using the deltaCt method, expressing results normalized to Actb as a loading control, since this reference gene is reportedly not modulated by caloric restriction (Gong et al, ) and did not vary significantly between nutritional states in this study. Lpar primer amplification efficiency has been validated as 100 ± 2%, allowing relative quantification and comparisons between different homologues within the same tissue (Fukushima et al, ).…”

In Contrast to Dietary Restriction, Application of Resveratrol in Mice Does not Alter Mouse Major Urinary Protein Expression

“…10 mg/day per kg bodyweight for 8 weeks did not affect Mup transcription (Figure 2). experiments (i.e., beta-2 microglobulin NCBI-ID 12010, hydroxymethylbilane synthase NCBI-ID 15288 [42]) appeared to be regulated by DR.…”

“…Unfortunately, we could not design a primer that would solely amplify the three Mup1 transcripts ( Table 1). We normalized mRNA levels to ribosomal 18S levels, since other housekeeping genes typically used in mouse experiments (i.e., beta-2 microglobulin NCBI-ID 12010, hydroxymethylbilane synthase NCBI-ID 15288 [42]) appeared to be regulated by DR.…”

Selection of reference genes for normalization of RT-qPCR data in gene expression studies in Anthonomus eugenii Cano (Coleoptera: Curculionidae)

“…Variation in www.nature.com/scientificreports www.nature.com/scientificreports/ the ranking order has been observed in many studies and can be attributed to the different statistical approaches implemented in the algorithms 23,24 . To address this issue, a comprehensive ranking of reference genes was created based on the ranking value attributed by the algorithms geNorm, NormFinder and BestKeeper as performed previously [25][26][27][28] . Figure 3.…”