Evaluation of in vitro ruminal fermentation of ensiled fruit byproducts and their potential for feed use

Mousa, Shimaa A; Malik, P. K.; Kolte, Atul P.; Bhatta, Raghavendra; Kasuga, Shigemitsu; Uyeno, Yutaka

doi:10.5713/ajas.18.0282

Cited by 8 publications

(18 citation statements)

References 25 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…We observed in a previous paper [4] that the inclusion of ensiled PS (without absorbent, at that time) decreased in vitro methane generation and that the change was likely dependent on the carbohydrate profile and on the compositional changes in the ensiled byproduct. From this viewpoint, we conceived that compositional changes in absorbents occuring during ensiling may affect in vitro rumen fermentation profile and methane generation.…”

Section: Introductionmentioning

confidence: 57%

“…The procedures for bag silage preparation and fermentation control were described in our previous reports [4,5]. Briefly, we cut PS to a short length (5-10 cm) before combining the inoculum and absorbents and mixed all materials well to ensure even distribution.…”

Section: Silage Preparationmentioning

confidence: 99%

“…In silage preparation, lactic acid bacteria (LAB) have been used to maintain the silage quality, since a high concentration of lactic acid and acetic acid is known to prevent the growth of some detrimental microorganisms (for instance, yeast and fungi), which can lead to silage deterioration [2,3]. After testing LAB strains, one strain (Lactobacillus buchneri) was identified to lead to the production of high-quality PS silage (PSS) [4,5]. Another important issue in silage preparation, especially when ensiling byproducts with high moisture content, is to minimize effluent loss.…”

Section: Introductionmentioning

confidence: 99%

See 2 more Smart Citations

Fermentative Quality and Animal Acceptability of Ensiled Persimmon Skin with Absorbents for Practical Use in Ruminant Feed

Mousa

Takeda

Kurosu

et al. 2020

Animals

Self Cite

View full text Add to dashboard Cite

Persimmon skin (PS), while representing an attractive feed source, requires an appropriate preservation procedure to increase its shelf life. We assessed the fermentation quality, in vitro ruminal incubation, and intake of persimmon skin silage ensiled with different dry absorbents. We prepared the silage on a table scale (Experiment 1) and evaluated five different mixtures: PS without an additive, PS plus Lactobacillus buchneri inoculum (LB), and PS plus LB plus each of the absorbents kraft pulp, wheat bran, or beet pulp. We opened the laboratory bags, kept at 25 °C, at 0, 14, 28, and 60 days for fermentation quality and chemical analysis (n = 3 for each measurement). Further, with an in vitro rumen simulated cultivation study (Experiment 2), we evaluated the fermentation pattern of PS with a mixture of two absorbents (kraft pulp and wheat bran) either raw (no fermentation) or ensiled (n = 4 for each treatment). Finally, we conducted an in vivo experiment using six dry ewes assigned based on their body weight to two experimental groups in a crossover design of two periods (Experiment 3). We fed a control group a 100% basal diet (tall fescue hay and concentrate mixture) and ensiled PS (PSS) group, a 20% dry matter substitution of tall fescue with PS silage mixed with kraft pulp as the sole absorbent. The results of Experiment 1 show, regardless of the absorbents used, the effluent volume of the lab bags was lower in absorbent-treated groups (p < 0.001). In Experiment 2, the condition of the PS with absorbents (raw or ensiled) did not affect the total gas production (p > 0.05), but we observed an increased propionate proportion in PSS with absorbents compared to basal diet (p = 0.019). The proportion of methane to the total gas in PSS group was considerably reduced compared with that in the other groups (p < 0.001). As we did this incubation study with a single run, a more detailed evaluation in the future would verify these observations. In the animal trial (Experiment 3), dry matter intake was similar between groups (p > 0.05), but ewes spent a shorter time eating in the PSS-fed group (p = 0.011). Here we present the practical use of PSS as part of ruminant feed in which dry absorbents prevented dry matter loss.

show abstract

Section: Introductionmentioning

confidence: 57%

Section: Silage Preparationmentioning

confidence: 99%

Section: Introductionmentioning

confidence: 99%

See 1 more Smart Citation

Fermentative Quality and Animal Acceptability of Ensiled Persimmon Skin with Absorbents for Practical Use in Ruminant Feed

Mousa

Takeda

Kurosu

et al. 2020

Animals

Self Cite

View full text Add to dashboard Cite

show abstract

“…Genomic DNA of the microorganisms was extracted from a precipitant (5,000 × g , 10 min,) of a thawed aliquot using the QIAamp DNA Stool Mini Kit (Qiagen) according to the protocol by the manufacturer, and the nucleic acid material was stored at less than −20°C until analysis. The PCR conditions and primer sequences for total bacteria were as previously reported (Mousa et al, ). Primer sets for real‐time PCR were Eub338F (ACTCCTACGGGAGGCAG) and Eub522R (ACGTCRTCCMCNCCTTCCTC) for total bacteria, qmcrA‐ F (TTCGGTGGATCDCARAGRGC) and qmcrA‐R (GBARGTCGWAWCCGTAGAATCC) for methanogenic Archaea, Fsuc3F (GTTCGGAATTACTGGGCGTAAA) and Fsuc3R (CCCCCGGACACCCAGTAT) for Fibrobacter , and RumFla3F (TGGCGGACGGGTGAGTAA) and RumFla3R (TTACCATCCGTTTCCAGAAGCT) for Ruminococcus flavefaciens .…”

Section: Methodsmentioning

confidence: 99%

Section: Microbiological and Organic Acid Analysismentioning

confidence: 99%

Provision of beta‐glucan prebiotics (cellooligosaccharides and kraft pulp) to calves from pre‐ to post‐weaning period on pasture

Kido

Tejima

Haramiishi

et al. 2019

Animal Science Journal

Self Cite

View full text Add to dashboard Cite

We conducted two feeding experiments to evaluate the effects of supplementation with either cellooligosaccharide or kraft pulp on growth performance in grazing beef calves (Japanese Black) from 4 weeks pre‐weaning to 12 to 16 weeks post‐weaning. In Experiment 1 (20‐week duration), nine calves (2.9‐month‐old females) were assigned to either a control group (CON) or an experimental group (CEL) fed cellooligosaccharide at a rate of 10 g/day mixed with concentrate. Average daily weight gain tended to be greater in CEL than in CON, especially after 1 month of weaning. In Experiment 2 (16‐week duration), 10 calves (2.0‐month‐old females) were assigned to either a control group or an experimental group (KRA) fed kraft pulp at a rate of 10% replacement of total digestible nutrients with concentrate. The proportion of fibrolytic bacteria increased and that of methanogenic Archaea decreased in the rumen microbial community composition of KRA calves in Experiment 2, whereas the decrease in Fibrobacter and Archaea was observed in CEL calves at first 4 weeks in Experiment 1. We conclude that beta‐glucan prebiotic supplementation to grazing calves at pre‐weaning would affect rumen microbial composition and modified rumen fermentation characteristics, leading to a better rumen environment via different means.

show abstract

Heat Stress on the Rumen Fermentation and Its Consequence

Uyeno

2021

Climate Change and Livestock Production: Recent Advances and Future Perspectives

View full text Add to dashboard Cite

Evaluation of in vitro ruminal fermentation of ensiled fruit byproducts and their potential for feed use

Cited by 8 publications

References 25 publications

Fermentative Quality and Animal Acceptability of Ensiled Persimmon Skin with Absorbents for Practical Use in Ruminant Feed

Fermentative Quality and Animal Acceptability of Ensiled Persimmon Skin with Absorbents for Practical Use in Ruminant Feed

Provision of beta‐glucan prebiotics (cellooligosaccharides and kraft pulp) to calves from pre‐ to post‐weaning period on pasture

Heat Stress on the Rumen Fermentation and Its Consequence

Contact Info

Product

Resources

About