Evaluation of Matrix-Assisted Laser Desorption Ionization−Time of Flight Mass Spectrometry for Identification of Mycobacterium abscessus Subspecies According to Whole-Genome Sequencing

Abstract

cThis study was undertaken to evaluate the utility of matrix-assisted laser desorption ionization-time of flight mass spectrometry with the Vitek MS Plus system for identifying Mycobacterium abscessus subspecies in order to facilitate more rapid and appropriate therapy. A total of 175 clinical M. abscessus strains were identified by whole-genome sequencing analysis: 139 Mycobacterium abscessus subsp. abscessus and 36 Mycobacterium abscessus subsp. massiliense. The research-use-only (RUO) Saramis Knowledge Base database v.4.12 was modified accordingly by adding 40 M. abscessus subsp. abscessus and 19 M. abscessus subsp. massiliense reference spectra to construct subspecies SuperSpectra. A blind test, used to validate the remaining 116 isolates, yielded 99.1% (n ‫؍‬ 115) reliability and only 0.9% (n ‫؍‬ 1) error for subspecies identification. Among the two subspecies SuperSpectra, two specific peaks were found for M. abscessus subsp. abscessus and four specific peaks were found for M. abscessus subsp. massiliense. Our study is the first to report differential peaks 3,354.4 m/z and 6,711.1 m/z, which were specific for M. abscessus subsp. massiliense. Our research demonstrates the capacity of the Vitek MS RUO Saramis Knowledge Base database to identify M. abscessus at the subspecies level. Moreover, it validates the potential ease and accuracy with which it can be incorporated into the IVD system for the identification of M. abscessus subspecies. Mycobacterium abscessus is one of the most common pathogens isolated from patients with cystic fibrosis and the second most prevalent, rapidly growing nontuberculous mycobacteria (NTM) species causing NTM pulmonary diseases (1, 2). Although it might not be the most virulent NTM pathogen, inherent antibiotic resistance makes it notoriously difficult to treat (3-7). Among multiple resistance mechanisms, resistance to macrolides is noteworthy (8). In this regard, acquired resistance to clarithromycin is always associated with a mutation in the 23S rRNA gene; intrinsic resistance is conferred mainly by the erythromycin methylase (erm) gene (3). The erm gene plays a significant role in the drug susceptibility and antibiotic resistance of M. abscessus. Mycobacterium abscessus is divided into three subspecies: Mycobacterium abscessus subsp. massiliense, Mycobacterium abscessus subsp. bolletii, and Mycobacterium. abscessus subsp. abscessus (9). The most meaningful genomic difference between the three subspecies is that M. abscessus subsp. massiliense possesses an incomplete and inactive erm gene, which is 276 bp in length and harbors deletion mutations at two positions (10-13). M. abscessus subsp. massiliense can acquire clarithromycin resistance as a consequence of a 23S rRNA mutation at position A2058 (12,14). Due to an inactive erm gene, M. abscessus subsp. massiliense does not exhibit inducible resistance after exposure to macrolides. M. abscessus subsp. abscessus and M. abscessus subsp. bolletii, on the other hand, exhibit inducible resistance (9, 15). As a result, lung diseas...

Evaluation of the VITEK MS knowledge base version 3.0 for the identification of clinically relevant Mycobacterium species

“…The M. abscessus complex, consisting of three subspecies ( M. massiliense , M. bolletii , and M. abscessus ), is the most common of the RGM species that cause NTM pulmonary diseases. Among these species, M. abscessus subsp abscessus is the dominating subspecies and is responsible for treatment failures, mainly due to the inducible resistance of an erm (position 28: C to T) mutation, which results in clarithromycin resistance, which would be impossible in M. abscessus subsp massiliense due to its incomplete erm gene 45 , 46 ; thus, different subspecies of M. abscessus infections may result in varied therapies 47 . However, although the correct identification rate was perfect for M. abscessus (the unidentified two isolates are smooth-growing, one each of M. abscessus subspecies abscessus and massiliense ), these subspecies could not be discriminated in the VITEK MS V3.0 knowledge database.…”

“…For species such as M. kansasii and M. gastri , M. fortuitum group, M. peregrinum and M. septicum , hsp65 PRA genes (FOR:ACCAACGATGGTGTGTCCAT and REV:CTTGTCGAACCGCATACCCT) were used to supplement the identification 50 , 51 . The erm gene was used for differentiating between Mycobacterium abscessus subspecies abscessus , bolletii and massiliense 45 . If the isolate identification obtained by VITEKVITEK MS Knowledge Base Version 3.0 was consistent with the gene sequence, then the result was considered as correct.…”

Relationship between Antibiotic Susceptibility and Genotype in Mycobacterium abscessus Clinical Isolates

“…DNA extraction was performed as we described previously with slight modification (Somerville et al, 2005 ; Luo et al, 2016 ). Ten microliters of bacteria were transferred to a microcentrifuge tube containing TE buffer and glass beads.…”

The Clarithromycin Susceptibility Genotype Affects the Treatment Outcome of Patients with Mycobacterium abscessus Lung Disease

“…Detailed methods were published previously by us ( 28 ). DNA was extracted according to the method of Somerville and coworkers ( 29 ), and paired-end libraries with insert sizes of ∼400 bp were prepared following Illumina's standard genomic DNA library preparation protocol (Illumina, San Diego, CA, USA).…”