Evaluation of Metabarcoding Primers for Analysis of Soil Nematode Communities

Abstract

While recent advances in next-generation sequencing technologies have accelerated research in microbial ecology, the application of high throughput approaches to study the ecology of nematodes remains unresolved due to several issues, e.g., whether to include an initial nematode extraction step or not, the lack of consensus on the best performing primer combination, and the absence of a curated nematode reference database. The objective of this method development study was to compare different primer sets to identify the most suitable primer set for the metabarcoding of nematodes without initial nematode extraction. We tested four primer sets for amplicon sequencing: JB3/JB5 (mitochondrial, I3-M11 partition of COI gene), SSU_04F/SSU_22R (18S rRNA, V1-V2 regions), and Nemf/18Sr2b (18S rRNA, V6-V8 regions) from earlier studies, as well as MMSF/MMSR (18S rRNA, V4-V5 regions), a newly developed primer set. We used DNA from 22 nematode taxa, 10 mock communities, 20 soil samples, 4 root samples, and one bulk soil. We amplified the target regions from the DNA samples with the four different primer combinations and sequenced the amplicons on an Illumina MiSeq sequencing platform. We found that the Nemf/18Sr2b primer set was superior for detecting soil nematodes compared to the other primer sets based on our sequencing results and on the annotation of our sequence reads at the genus and species ranks. This primer set generated 74% reads of Nematoda origin in the soil samples. Additionally, this primer set did well with the mock communities, detecting all the included specimens. It also worked better in the root samples than the other primer set that was tested. Therefore, we suggest that the Nemf/18Sr2b primer set could be used to study rhizosphere soil and root associated nematodes, and this can be done without an initial nematode extraction step.

Phytohormones selectively affect plant parasitic nematodes associated with Arabidopsis roots

“…We amplified the V6–V8 region of nematode 18S rRNA using the primers Nemf (5′‐GGGGAAGTATGGTTGCAAA‐3′) and 18Sr2b (5′‐TACAAAGGGCAGGGACGTAAT‐3′) (Porazinska et al ., 2009; Sapkota & Nicolaisen, 2015). This primer set is effective in detecting a high diversity of nematodes in root samples (Sikder et al ., 2020). Besides, we amplified the V3–V4 region of the bacterial 16S rRNA gene using the primers S‐D‐Bact‐0341‐b‐S‐17 (5′‐CCTACGGGNGGCWGCA G‐3′) and S‐D‐Bact‐0785‐a‐A‐21 (5′‐GACTACHVGGGTATCTAATCC‐3′) (Klindworth et al ., 2013) and the fungal internal transcribed spacer (ITS)2 region using the primers fITS7 (5′‐GTGARTCATCGAATCTTTG‐3′) and ITS4 (5′‐TCCTCCGCTTATTGATATGC‐3′) (Ihrmark et al ., 2012).…”

“…Although the roles of specific phytohormones on particularly PPN have in some cases been elucidated, the roles of these hormones on communities of nematodes, including free‐living nematodes, have not been well investigated. High throughput sequencing technologies recently have opened new avenues for description of the soil nematofauna in studies of such complex phytohormone–nematode community interactions in natural plant–soil systems (Porazinska et al ., 2009; Sikder et al ., 2020).…”

Direct and Indirect Effects on Soil Nematode Communities Differ Between Facilitative and Allelopathic Plants

“…In order to improve ampli cation e ciency, a higher proportion of nematode sequences can be obtained without nematode enrichment, we repeated DNA ampli cation before sequencing. The primers NemF and 18Sr2b (Sikder et al 2020) were used in a pre-ampli cation step followed by ampli cation with primers NF1 and 18Sr2b in a semi-nested procedure (Sapkota and Nicolaisen 2015) (Table S1). NF1 and 18Sr2b were tag encoded using the forward primer 5 -CGTATCGCCTCCCTCGCGCCATCAG-MID-NF1-3 and the reverse primer 5 -CTATGCGCCTTGCCAGCCCGCTCAG-18Sr2b-3 (Sapkota and Nicolaisen 2015).…”

Effects of source sample amount on biodiversity surveys of bacteria, fungi, and nematodes in soil ecosystems

“…In expanding the use of DNA metabarcoding of soil biodiversity, it is of particular importance to develop standard protocols applicable to broad ranges of situations and organisms. For example, universal primers with high taxonomic coverage have been proposed for each of bacterial 16S rRNA (Klindworth et al, 2013; Thijs et al, 2017), fungal ITS (Schoch et al, 2012; Lindahl et al, 2013; op de Beeck et al, 2014), and nematode 18S rRNA regions (Sapkota and Nicolaisen, 2015; Ahmed et al, 2019; Waeyenberge et al, 2019; Sikder et al, 2020; Kenmotsu et al, 2021). For the bioinformatic processes, rapid and accurate algorithms for inferring operational taxonomic units (OTUs) or amplicon sequence variants (ASVs) have been implemented (Callahan et al, 2016).…”