Evaluation of molecular markers for the diagnosis of Mycobacterium bovis

Abstract

Mycobacterium tuberculosis complex (MTC) comprises a group of bacteria that have a high degree of genetic similarity. Two species in this group, Mycobacterium tuberculosis and Mycobacterium bovis, are the main cause of human and bovine tuberculosis, respectively. M. bovis has a broader host range that includes humans; thus, the differentiation of mycobacterium is of great importance for epidemiological and public health considerations and to optimize treatment. The current study aimed to evaluate primers and molecular markers described in the literature to differentiate M. bovis and M. tuberculosis by PCR. Primers JB21/22, frequently cited in scientific literature, presented in our study the highest number of errors to identify M. bovis or M. tuberculosis (73%) and primers Mb.400, designed to flank region of difference 4 (RD4), were considered the most efficient (detected all M. bovis tested and did not detect any M. tuberculosis tested). Although also designed to flank RD4, primers Mb.115 misidentified eight samples due to primer design problems. The results showed that RD4 is the ideal region to differentiate M. bovis from other bacteria classified in MTC, but primer design should be considered carefully.

Validation of two real-time PCRs targeting the PE-PGRS 20 gene and the region of difference 4 for the characterization of Mycobacterium bovis isolates

“…The DNA sequence detected by qPCR Mbovis.88 (targeting RD4 in M. bovis genome) was only present in strains derived from M. bovis, and did not exist in the M. tuberculosis complex, even in those most genetically similar species like M. caprae (Garnier et al, 2003;Sales et al, 2014). Because of the MTC clonal profile and the low rate of recombination, a reversal in this deleted region is unlikely.…”

Identificação e genotipagem de Mycobacterium bovis em bovinos positivos no teste intradérmico para tuberculose em Mato Grosso do Sul

“…Além disso, em um estudo realizado por Sechi et al (2000), concluiu-se que nem todas as cepas de M. bovis podem ser identificadas com oligonucleotídeos JB21/JB22 direcionados para o fragmento de 500 pb, uma vez que esse fragmento pode estar ausente, gerando resultados falso-negativos. Portanto, a adição de mais um par de oligonucleotídeos com alvo para uma sequência diferente, como em uma mPCR, diminui a ocorrência destes resultados (Figueiredo et al 2010, Sales et al 2014. Cabe destacar que os oligonucleotídeos JB21/JB22 foram inicialmente propostos como específicos para M. bovis (Rodríguez et al 1995).…”

Molecular characterization of Mycobacterium bovis infection in cattle and buffalo in Amazon Region, Brazil

“…The mycobacterial DNA samples were submitted to standard PCR according to Sales et al (), using primers Mb.400.F (5′AACGCGACGACCTCATATTC3′) and Mb.400.R (5′AAGGCGAACAGATTCAGCAT3′), which amplify a 400 base pair DNA fragment flanking the region of differentiation 4, specific to M. bovis (Ramos et al, ). The PCR products were stained with Gel Red and submitted to 1% agarose gel electrophoresis in 1× TAE buffer and visualized in a PhotoDocumentor under ultraviolet light.…”