Evaluation of short mitochondrial metabarcodes for the identification of Amazonian mammals

Abstract

Summary DNA barcoding and metabarcoding are increasingly used as alternatives to traditional morphological identifications. For animals, the standard barcode is a c. 658‐bp portion of the COI gene, for which reference libraries now cover a large proportion of described mammal species. Unfortunately, because its sequence is too long and does not contain highly conserved primer binding sites, this marker is not adapted for metabarcoding. Although alternative metabarcodes have been developed, their performances are generally seldom assessed. We evaluate the reliability of a short metabarcode located in the mitochondrial 12S ribosomal RNA for the identifications of Amazonian mammals. We (i) constitute a nearly exhaustive reference library for species found in French Guiana, (ii) assess the taxonomic resolution of the marker and validate its use with dipteran blood meal analyses, (iii) assess the conservation of the primer binding sites, and (iv) compare its theoretical performances with that of a newly designed metabarcode located within the standard COI barcode. About 576 specimens representing 164 species were gathered and sequenced. We show that the 12S marker allows remarkably accurate taxonomic assignations despite its very short size, and that primer binding sites are highly conserved, which is important to avoid PCR amplification bias potentially leading to detection failure. Additionally, our results stress that the identifications should only be considered at the generic level when they are based on incomplete reference libraries, even when a stringent similarity cut‐off is used. A new short COI metabarcode was designed based on 569 reference sequences of mammals retrieved on BOLD. Our results clearly show that, while both markers provide similar taxonomic resolution, much higher rates of primer mismatches are found with COI. Besides demonstrating the accuracy of the short 12S marker for the identification of Amazonian mammals and providing a reliable molecular reference database, this study emphasizes that the accuracy of taxonomic assignations highly depends on the comprehensiveness of the reference library and that great caution should be taken for interpreting metabarcoding results based on scarce reference libraries. The comparison with a short COI metabarcode also provides novel evidence in support for the use of ribosomal markers in metabarcoding studies.

Biodiversity assessments in the 21st century: the potential of insect traps to complement environmental samples for estimating eukaryotic and prokaryotic diversity using high-throughput DNA metabarcoding

“…On the other hand, most insects in the COI dataset were identified at least to the family level, while with the 18S dataset most matchings could be made at the order level (Tables S3 2 -S5 2 ). Using markers with better taxonomic resolution or more specific for target groups, the bulk insect samples could also be used for monitoring rare or hard-to-sample groups, for instance mammals (Kocher et al 2017), or network interactions such as plant-insects (Kergoat et al 2017) and host-parasite interactions (Toju 2015).…”

iDNA screening: Disease vectors as vertebrate samplers

“…We extracted DNA from each engorged female using a without‐boiling Chelex protocol (Casquet, Thebaud, & Gillespie, ). Two PCR were then performed: the first to amplify the Ins16S_1 marker (Ins16S_1‐F: TRRGACGAGAAGACCCTATA; Ins16S_1‐R: TCTTAATCCAACATCGAGGTC; Clarke, Soubrier, Weyrich, & Cooper, ), which allows species‐level identifications of mosquitoes and sand flies (Kocher et al., ; Talaga, Leroy, et al., ); the second to amplify the 12S‐V5 marker (12S‐V5‐F: TAGAACAGGCTCCTCTAG; 12S‐V5‐R: TTAGATACCCCACTATGC; Riaz et al., ), that was shown to provide accurate identifications of mammals (Kocher et al., ). The 12S‐V5 marker was designed for metabarcoding of vertebrates.…”

“…Taxonomic assignment of sequences was performed with ecotag (part or the obitools package). We used reference libraries for Amazonian sand flies (Kocher et al., ), mammals (Kocher et al., ) and mosquitoes (Data set ) that we further complemented with sequences from GenBank using ecoPCR (Riaz et al., ). When a sequence had less than 97% identity with its best match in the reference database, we considered the taxonomic assignment at the generic rank or above.…”

Toward an ecoregion scale evaluation of eDNA metabarcoding primers: A case study for the freshwater fish biodiversity of the Murray–Darling Basin (Australia)

“…For example, the commonly used cytochrome c oxidase subunit I (COI) gene lacks highly conserved regions needed for robust metabarcoding primer design (Deagle, Jarman, Coissac, Pompanon, & Taberlet, ). While incorporating a high degree of base degeneracy can improve the performance of COI primers (Elbrecht & Leese, ), mitochondrial ribosomal RNA (rRNA) gene regions are increasingly being used to minimize primer‐template mismatches, and the amplified barcodes have a taxonomic resolution similar to standard COI barcodes (Kocher et al., ; Riaz et al., ; Valentini, Pompanon, & Taberlet, ). Given that there are no truly “universal” metabarcoding primers, selecting the most suitable primers will always require balancing the trade‐offs that exist between the four criteria mentioned previously (Valentini et al., ).…”