Evidence for estrogen receptor expression in germ cell and somatic cell subpopulations in the ovary of the newly hatched chicken

Abstract

Estrogens are involved in the gonadal morphogenesis of vertebrates, and almost all hormonal effects of 17beta-estradiol are mediated through specific receptors. At the time of sexual differentiation in the chicken, or even before, there is evidence of the presence of estrogen receptors and the secretion of 17beta-estradiol. However, no information is available regarding the cellular types that express the estrogen receptor in the immature chick ovary. The present study analyzes estrogen receptor expression in germ and somatic cells of the ovary in the newly hatched chicken. Highly purified cell subpopulations of germ and somatic cells were evaluated for specific 17beta-estradiol nuclear binding. In addition, the estrogen receptor was localized at the ultrastructural level by the immunogold technique. Finally, reverse transcription and polymerase chain reaction procedures detected a steady-state level of mRNA for the estrogen receptor. Somatic cells including typical steroidogenic cells showed specific 17beta-estradiol nuclear binding, displayed the estrogen receptor, and possessed estrogen receptor transcripts. The same result was observed in primary oocytes, together with the ultrastructural localization of estrogen receptor in extended chromatin filaments. Our experimental data support the hypothesis that estrogens are involved in the function of somatic and germ cells subpopulations in the immature chicken ovary.

Changes in estrogen receptor alpha expression in the bursa of Fabricius during chick embryonic development

“…Polymerase chain reaction (PCR) was performed in a 20 µL reaction volume containing 0.5 µL of cDNA, 2 µL of 10X PCR buffer, 0.2 mmol dNTP, 0.5 µL of each primer and 0.25 U of Taq DNA polymerase (Amersham Biosciences, Piscataway, NJ, USA) under the following conditions: in the case of ERα, 30 s of denaturation at 94°C, 30 s of annealing at 59°C and 60 s of extension at 72°C for 35 cycles, and in the case of β‐actin, 30 s of denaturation at 94°C, 30 s of annealing at 59°C and 60 s of extension at 72°C for 25 cycles using the following primers: forward: 5′‐CGTGGAA AGCAACAAGAC A‐3′ and reverse: 5′‐AAGCCTCCC CGTTCCTG G‐3′ which were designed based on the sequence of chicken ERα cDNA (Mendez et al . 1999), and forward: 5′‐GATATGGAGAAGATCTGGCACC‐3′ and reverse: 5′‐TGAAGGTCTCAAACATGATCTG‐3′ which were designed based on the sequence of chicken β‐actin cDNA (Bernard et al .…”

“…The expression of messenger RNA (mRNA) of estrogen receptor α (ERα), the classical ER (Walter et al . 1985), has been demonstrated in chicken ovary cells (Mendez et al . 1999).…”

Estrogen receptor alpha expression in the thymus of chick embryos during late stages of embryogenesis

“…The extracted RNA was treated with DNase I (TaKaRa Bio, Ohtsu, Japan) and cDNA synthesis was carried out using oligo dT 12‐18 primer (Invitorogen) and SuperScript II Reverse Transcriptase (Invitrogen) from 5 μg of the RNA. PCR was performed using the primers forward 5′‐CGTGGAAAGCAACAAGACA‐3′, and reverse 5′‐AAGCCTCCCCGTTCCTGG‐3′, which were designed based on the sequence of chicken ERα cDNA (Mendez et al . 1999), and forward 5′‐CCTGGCT CAAAAAGATGC‐3′ and reverse 5′‐CCCATG CAATCT TCTG, which were designed based on the sequence of chicken ERβ cDNA (Sakimura et al .…”

Evidence for estrogen receptor expression in the bursal epithelial cells of chicks

“…The expression of messenger RNA (mRNA) of estrogen receptor (ER) α (ER‐α), the classical ER (Walter et al . 1985), has been demonstrated in chicken ovary cells (Mendez et al . 1999).…”