Evidence for evolution of canine parvovirus type 2 in Italy

Abstract

Two isolates of canine parvovirus (CPV) were obtained from dogs affected with severe haemorrhagic diarrhoea. Type 2b antigenic specificity was predicted by both antigenic analysis with monoclonal antibodies and PCR characterization with type-specific primers. Nevertheless, sequence analysis of the capsid protein-encoding gene revealed two amino acid changes. One of the changes affected position 426 (Asp to Glu), in a major antigenic site of the viral capsid, determining the replacement of a residue unique to CPV type 2b. The failure of established typing methods to distinguish this antigenic variant was overcome by the development of an RFLP assay. During the early 1970s, a new infectious disease of pups, characterized by either gastroenteritis or myocarditis, was observed worldwide. A small, round, non-enveloped virus was observed by electron microscopy in stool specimens and in tissues of affected animals. Subsequently, a novel parvovirus was isolated both in canine and feline cell cultures (Kelly, 1978 ; Appel et al., 1979 ; Burtonboy et al., 1979 ; Johnson & Spradbrow, 1979). The virus was named canine parvovirus type 2 (CPV-2), to distinguish it from the previously described parvovirus canine minute virus (CMV or CPV-1), which is antigenically unrelated to CPV-2 (Carmichael & Binn, 1981 ; Carmichael et al., 1994). CPV possesses a single-stranded DNA genome of negative polarity, about 5200 nt in length. The CPV capsid is a 26 nm diameter icosahedron made up of a combination of two proteins, VP1 and VP2, formed by alternative splicing from the same RNA (Reed et al., 1988). The mutation rate of the CPV genome has not been determined ; however, since parvovirus DNA is replicated by host cell DNA polymerases (Cotmore &

Isolation and Typing of Canine Parvovirus in CRFK Cell Line in Puducherry, South India

“…After its emergence in the late 1970s [2] CPV-2 underwent a rapid evolution and, within few years, new antigenic types termed CPV-2a and CPV-2b, completely replaced the original CPV-2 [3]. Few years back an antigenic variant had been reported in Italy [4]. That variant has an amino acid substitution, Asp-426 ?…”

Parasitology, Virology, and Serology of Free-Ranging Coyotes (Canis latrans) from Central Georgia, USA

“…To screen for parvoviruses, DNA was extracted from a 200-mL mixture of fecal material and an equal volume of phosphate-buffered saline using the QIAamp DNA Blood Mini Kit (Qiagen, Valencia, California, USA), according to manufacturer's instructions, and processed by real-time PCR, following diagnostic protocol at the University of Tennessee College of Veterinary Medicine. Parvovirus typing was performed on PCRpositive samples, following Buonavoglia et al (2001).…”

Viral type characterization and clinical aspects of canine parvovirus in naturally infected dogs in São Paulo State, Brazil

“…All samples were submitted to hemagglutination (HA) technique in accordance to Senda et al (1986), considering as positive titers equal or greater than 80 UHA. Twenty samples resulted as positive in HA were than submitted to PCR with primers 555F 5'CAGGAAGATATCCA-GAAGGA3' and 555R 5'GGTGCTAGTTGATATGTAATAAACA3', resulting in a fragment of 583 bp from VP2 (Buonavoglia et al 2001).…”

“…Amplified products were purified with a purification kit and were sequenced with both forward and reverse primers (Buonavoglia et al 2001) with an automated sequencer according to the manufacturer's instructions. The complete sequence assembly was created with sequence assembly program (Ewing & Greene 1998, Huang & Madan 1999 using nucleotide data with a quality higher than 20.…”

“…To detect and characterize canine parvovirus in our region, fecal samples from dogs clinically suspected for canine parvovirus were collected and submitted for laboratory diagnosis by means of a hemagglutination test (Greene 2012, Senda et al 1986); the samples that showed positive results were submitted for PCR (Buonavoglia et al 2001), and subsequently, were sequenced for subtype characterization. The results were associated with age, hematological values, survival, and vaccination status.…”