Evidence of genome-wide G4 DNA-mediated gene expression in human cancer cells

Abstract

Guanine-rich DNA of a particular sequence adopts four-stranded structural forms known as G-quadruplex or G4 DNA. Though in vitro formation of G4 DNA is known for several years, in vivo presence of G4 DNA was only recently noted in eukaryote telomeres. Recent bioinformatics analyses showing prevalence of G4 DNA within promoters of human and related species seems to implicate G4 DNA in a genome-wide cis-regulatory role. Herein we demonstrate that G4 DNA may present regulatory sites on a genome-wide scale by showing widespread effect on gene expression in response to the established intracellular G4 DNA-binding ligands. This is particularly relevant to genes that harbor conserved potential G4 DNA (PG4 DNA) forming sequence across human, mouse and rat promoters of orthologous genes. Genes with conserved PG4 DNA in promoters show co-regulated expression in 79 human and 61 mouse normal tissues (z-score > 3.5; P < 0.0001). Conservation of G4 DNA across related species also emphasizes the biological importance of G4 DNA and its role in transcriptional regulation of genes; shedding light on a relatively novel mechanism of regulation of gene expression in eukaryotes.

Binding of G-quadruplexes to the N-terminal Recognition Domain of the RNA Helicase Associated with AU-rich Element (RHAU)

“…Although the formation of quadruplexes in compatible sequences of DNA and RNA was originally considered to be an in vitro artifact of laboratory research, there is now compelling evidence that suggests that their formation in vivo may have great importance to a variety of biochemical processes (10,11). In silico studies suggest a widespread prevalence of RNA and DNA quadruplexes, and this trend has been confirmed experimentally by several studies that demonstrate that formation of G-quadruplexes impacts transcriptional control in promoter regions of genes and modulates translational repression or activation via quadruplex formation in the untranslated regions (UTRs) of mRNAs (12)(13)(14)(15)(16). Given that melting temperatures of quadruplexes are much higher than physiological temperature, manipulation of these unusually stable structures to provide regulatory control requires the work of specialized enzymes in living systems.…”

“…Quadruplex Production and Purification-Synthetic hTR [1][2][3][4][5][6][7][8][9][10][11][12][13][14][15][16][17][18][19][20] RNA (5Ј-GGGUUGCGGAGGGUGGGCCU-3Ј, where the underlining highlights the guanines; Integrated DNA Technologies) was dissolved in 20 mM HEPES, pH 7.5, 100 mM KCl, 1 mM EDTA at a concentration of 5 M. RNA was heated to 95°C for 5 min, allowed to passively cool to room temperature outside the heat bath, and then purified by SEC on a HiLoad Superdex TM 75 26/60 size exclusion chromatography column (Ä KTA FPLC , GE Healthcare). Synthetic DNA quadruplexes (Alpha DNA, Canada) were dissolved in the above HEPES buffer but without adding EDTA, heated to 95°C, and allowed to cool slowly to room temperature inside the metal heat block or water bath.…”

“…All DNA synthesis batches exhibited the same result. Extinction coefficients (⑀ 260 nm ) were calculated from the sequence using IDT SciTools (PrimerQuest program, Integrated DNA Technologies) and corrected for hyperchromicity using the absorption spectra at 20 and 80°C: hTR [1][2][3][4][5][6][7][8][9][10][11][12][13][14][15][16][17][18][19][20] (22) and dsRNA (HIV-1 trans-activation response element, GGUCUCUCUGGUUAAGCCAGAUCUGAGCCUG-GGAGCUCUCUGGCUAACUAGGGAACC) (29) controls were used.…”

“…1A). To achieve effective separation, a large scale preparatory column was used that resolved two separate peaks: DNA 1-20 C1 (first eluted species) and DNA [1][2][3][4][5][6][7][8][9][10][11][12][13][14][15][16][17][18][19][20] C2 (second eluted species). Both DNA species migrated similarly and stained efficiently with quadruplex-specific dye ( Fig.…”

“…The phosphate buffer has a much lower absorbance and was used to extend the measurable spectral range from 210 to 180 nm. Thermal melting curves following the ellipticity at 263 (DNA [1][2][3][4][5][6][7][8][9][10][11][12][13][14][15][16][17][18][19][20] or 264 nm (hTR [1][2][3][4][5][6][7][8][9][10][11][12][13][14][15][16][17][18][19][20] were recorded for each of the quadruplexes in the mentioned HEPES buffer. The spectra were normalized by the number of bases per unit volume.…”