EXOC1 plays an integral role in spermatogonia pseudopod elongation and spermatocyte stable syncytium formation in mice

Abstract

The male germ cells must adopt the correct morphology at each differentiation stage for proper spermatogenesis. The spermatogonia regulates its differentiation state by its own migration. The male germ cells differentiate and mature with the formation of syncytia, failure of forming the appropriate syncytia results in the arrest at the spermatocyte stage. However, the detailed molecular mechanisms of male germ cell morphological regulation are unknown. Here, we found that EXOC1, a member of the Exocyst complex, is important for the pseudopod formation of spermatogonia and spermatocyte syncytia in mice. EXOC1 contributes to the pseudopod formation of spermatogonia by inactivating the Rho family small GTPase Rac1 and also functions in the spermatocyte syncytia with the SNARE proteins STX2 and SNAP23. Since EXOC1 is known to bind to several cell morphogenesis factors, this study is expected to be the starting point for the discovery of many morphological regulators of male germ cells.

Disrupted intercellular bridges and spermatogenesis in fatty acyl‐CoA reductase 1 knockout mice: A new model of ether lipid deficiency

“…Interestingly, in both STX2 mutant and Far1 KO testes, TEX14 was found on the MGC membrane in an aberrant patchy pattern, 58 indicating a defective ICB protein complex assembly and targeting. Similarly, multinucleated spermatocytes lacking ICB structures were observed in mice with a conditional KO of EXOC1, a member of the Exocyst complex 59 . In male fruit flies, mutations in conserved cytokinesis genes prevented normal ring canal formation, the alternate name of ICB in Drosophila , and created multinucleated germ cells 60–62 .…”

“…structures were observed mice with a conditional of EXOC1, a member of the Exocyst complex. 59 In male fruit flies, mutations in conserved cytokinesis genes prevented normal ring canal formation, the alternate name of ICB in Drosophila, and created multinucleated germ cells. [60][61][62] These multinucleated cells developed into multinucleated spermatids.…”

“…A similar stage-specific requirement in germ cell cytokinesis was found for syntaxin 2 (STX2), an essential player in abscission. 56 In the STX2 nonsense mutant, as well as the KO mice, [57][58][59] STX2 deficiency disrupted ICBs and produced multinucleated spermatocytes. Interestingly, in both STX2 mutant and Far1 KO testes, TEX14 was found on the MGC membrane in an aberrant patchy pattern, 58 indicating a defective ICB protein complex assembly and targeting.…”

Birth of mice from meiotically arrested spermatocytes following biparental meiosis in halved oocytes

“…The repro34 mutation was induced in a C57BL/6J male and subsequently, a congenic line with the C3HeB/FeJ background was created (Akiyama et al , 2008). Germline‐specific Exoc1 conditional knockout mice were generated by breeding Exoc1 tm1c(EUCOMM)Hmgu mice (Skarnes et al , 2011) with Nanos3 ‐Cre driver mice (kindly gifted by Dr Y. Saga, RIKEN BRC RBRC02568), which express Cre in spermatogonia (Suzuki et al , 2008; Osawa et al , 2021). D1Pas1 knockout mice were provided by RIKEN BioResource Center (RBRC05432).…”

“…The PCR products were sequenced to detect the point mutation. For Exoc1 conditional knockout, Exoc1‐cKO genotyping 3‐1 (AGTCTTCCTTCCCTGGGTTG) and Exoc1‐cKO genotyping n3‐3 (CCGGATTGATGGTAGTGGTC) were used (modified from Osawa et al , 2021).…”