Exon–Intron Organization of the Human Type 2 Desmocollin Gene (DSC2): Desmocollin Gene Structure Is Closer to “Classical” Cadherins Than to Desmogleins

Repression of the Desmocollin 2 Gene Expression in Human Colon Cancer Cells Is Relieved by the Homeodomain Transcription Factors Cdx1 and Cdx2

“…Together, these findings support the hypothesis that DSC2 gene expression is regulated by the intestine-specific transcription factors Cdx1 and Cdx2 in human colon cancer cells. The human DSC2 gene is found on chromosome 18 at q12.1 (24,25). The cloning and description of the promoter for the human DSC2 gene has been reported (4).…”

“…Although other cell-cell adhesion proteins are recognized as Cdx transcriptional targets (11,12), this would be the first report to tie Cdx1 and Cdx2 to the regulation of intestinal cell desmosomes and DSC2 gene expression. Moreover, it is the first report to our knowledge exploring the molecular regulation of the DSC2 promoter and DSC2 gene expression since a description of the gene was first published (4,25).…”

Characterization of Two Novel Protocadherins (PCDH8andPCDH9) Localized on Human Chromosome 13 and Mouse Chromosome 14

“…In general, they consist of 15 to 17 exons with large first and/or second introns and highly conserved exon-intron boundaries. Both subfamilies contain two introns in the region, corresponding to each cadherin repeat, and show an identical lateral displacement of their exon boundaries along the repeats (Greenwood et al, 1997;and references therein). The genomic organization of protocadherin PCDH8 differs remarkably from that of the classical and desmosomal cadherins, in that it consists of only three exons.…”

“…The cytoplasmic domain of the classical cadherins is the most conserved region, and the desmosomal cadherins share similarity in the regions that are thought to mediate interactions with the actin-based cytoskeleton (Gumbiner, 1996;Suzuki, 1996a). In addition, classical and desmosomal cadherins share a similar genomic organization in that they exhibit a remarkable degree of conservation in intron position (Greenwood et al, 1997;and references therein).…”

Cloning and expression throughout mouse development ofmfat1, a homologue of theDrosophila tumour suppressor genefat

“…As a positive control, E-cadherin primers B8 (ggtgccgaattcagcgcgctgagatg) and B9 (ttctgggaattcgcgagcttgagatgga) (Collins et al, 1995), designed to amplify a region of approximately 400 bp spanning E-cadherin repeats 4 and 5, were used in 33 cycles of a PCR reaction: 95°C, 30 sec; 53°C, 30 sec, and 72°C, 40 sec. Genomic contamination of cDNA was excluded using intron-differential RT-PCR with desmocollin 2 intron 10-flanking primers RSB 248 and RSB249 (Greenwood et al, 1997) employed under standard thermocycling conditions with an annealing temperature of 50°C.…”