Exosomes released by breast cancer cells under mild hyperthermic stress possess immunogenic potential and modulate polarization in vitro in macrophages

Abstract

Macrophages play a dual role in tumor initiation and progression, with both tumor-promoting and tumor-suppressive effects; hence, it is essential to understand the distinct responses of macrophages to tumor progression and therapy. Mild hyperthermia has gained importance as a therapeutic regimen against cancer due to its immunogenic nature, efficacy, and potential synergy with other therapies, yet the response of macrophages to molecular signals from hyperthermic cancer cells has not yet been clearly defined. Due to limited response rate of breast cancer to conventional therapeutics the development, and understanding of alternative therapies like hyperthermia is pertinent. In order to determine conditions corresponding to mild thermal dose, cytotoxicity of different hyperthermic temperatures and treatment durations were tested in normal murine macrophages and breast cancer cell lines. Examination of exosome release in hyperthermia-treated cancer cells revealed enhanced efflux and a larger size of exosomes released under hyperthermic stress. Exposure of naïve murine macrophages to exosomes released from 4T1 and EMT-6 cells posthyperthermia treatment, led to an increased expression of specific macrophage activation markers. Further, exosomes released by hyperthermia-treated cancer cells had increased content of heat shock protein 70 (Hsp70). Together, these results suggest a potential immunogenic role for exosomes released from cancer cells treated with mild hyperthermia.

Antigen-encapsulating host extracellular vesicles derived from Salmonella-infected cells stimulate pathogen-specific Th1-type responses in vivo

“…The transcription of IL-1β, COX-2, IL-12p40, SOCS3, MSR1 andMRC1 was analyzed by qPCR, as we described previously [ 57 ]. The transcription of murine iNOS and Arg-1 were analyzed by using the primers described previously [ 60 ], while transcripts of TNF, IL-10 were performed utilizing the following primer sequences: TNF-Forward:CCTGTAGCCCACGTCGTAGC; TNF-Reverse:AGCAATGACTCCAAAGTAGACC; IL-10 Forward: TGCACTACCAAAGCCACAAAGCAG; IL-10 Reverse:TCAGTAAGAGCAGGCAGCATAGCA. Briefly, RNA was extracted from cells using a Qiagen RNeasy Mini Plus extraction kit.…”

Local hyperthermia combined with CTLA-4 blockade induces both local and abscopal effects in a murine breast cancer model

“…Although no preclinical and clinical evidence suggests that local HT has the ability to induce a systemic antitumor response, recent studies have demonstrated that antitumor immunity is stimulated by local HT via HSP induction [10,12,29]. A recent study reported that exosomes released from breast cancer cells treated with HT possessed an immunogenic potential [30]. Together with the strong enhancement of T cell activity and Treg blocking function by C4 [17], we hypothesized that local HT in combination with C4 could enhance systemic antitumor efficacy and alter immune cell microenvironments not only in local tumors but also in distant tumors.…”

Extracellular Vesicles as Drug Vectors for Precise Cancer Treatment

“…Changes in temperature have been shown to impact the efflux quantity of EVs by tumor cells. One study found that high temperatures in tumor hyperthermia significantly enhance the release of tumor cell EVs [94]. However, this hyperthermia method also caused the volume of each individual EV to increase.…”