Expanding the spectrum of EWSR1‐PATZ1 rearranged CNS tumors: An infantile case with leptomeningeal dissemination

Rossi, Sabrina; Barresi, Sabina; Giovannoni, Isabella; Alesi, Viola; Ciolfi, Andrea; Colafati, Giovanna Stefania; Diomedi-Camassei, Francesca; Miele, Evelina; Cacchione, Antonella; Quacquarini, Denise; Carai, Andrea; Tartaglia, Marco; Giannini, Caterina; Giangaspero, Felice; Mastronuzzi, Angela; Alaggio, Rita

doi:10.1111/bpa.12934

Cited by 13 publications

(6 citation statements)

References 9 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…In the EWSR1:PLAGL1 fusions described here, the whole N-terminal transcriptional activation domain (TAD) of EWSR1 is fused in-frame to the zinc finger domain (with DNA binding activity) of PLAGL1, very similar to other oncogenic EWSR1 fusions, in particular rearrangements between EWSR1 and PATZ1 [28,30]. This indicates aberrant recruitment of the TAD of EWSR1 to the DNA binding domain of PLAGL1 with subsequent downstream effects, as described for other EWSR1 rearrangements, as the likely oncogenic function of this fusion [11].…”

Section: Discussionmentioning

confidence: 99%

Recurrent fusions in PLAGL1 define a distinct subset of pediatric-type supratentorial neuroepithelial tumors

et al. 2021

View full text Add to dashboard Cite

Ependymomas encompass a heterogeneous group of central nervous system (CNS) neoplasms that occur along the entire neuroaxis. In recent years, extensive (epi-)genomic profiling efforts have identified several molecular groups of ependymoma that are characterized by distinct molecular alterations and/or patterns. Based on unsupervised visualization of a large cohort of genome-wide DNA methylation data, we identified a highly distinct group of pediatric-type tumors (n = 40) forming a cluster separate from all established CNS tumor types, of which a high proportion were histopathologically diagnosed as ependymoma. RNA sequencing revealed recurrent fusions involving the pleomorphic adenoma gene-like 1 (PLAGL1) gene in 19 of 20 of the samples analyzed, with the most common fusion being EWSR1:PLAGL1 (n = 13). Five tumors showed a PLAGL1:FOXO1 fusion and one a PLAGL1:EP300 fusion. High transcript levels of PLAGL1 were noted in these tumors, with concurrent overexpression of the imprinted genes H19 and IGF2, which are regulated by PLAGL1. Histopathological review of cases with sufficient material (n = 16) demonstrated a broad morphological spectrum of tumors with predominant ependymoma-like features. Immunohistochemically, tumors were GFAP positive and OLIG2- and SOX10 negative. In 3/16 of the cases, a dot-like positivity for EMA was detected. All tumors in our series were located in the supratentorial compartment. Median age of the patients at the time of diagnosis was 6.2 years. Median progression-free survival was 35 months (for 11 patients with data available). In summary, our findings suggest the existence of a novel group of supratentorial neuroepithelial tumors that are characterized by recurrent PLAGL1 fusions and enriched for pediatric patients.

show abstract

Section: Discussionmentioning

confidence: 99%

Recurrent fusions in PLAGL1 define a distinct subset of pediatric-type supratentorial neuroepithelial tumors

et al. 2021

View full text Add to dashboard Cite

show abstract

“…In the EWSR1:PLAGL1 fusions described here, the whole N-terminal transcriptional activation domain (TAD) of EWSR1 is fused in-frame to the zinc finger domain (with DNA binding activity) of PLAGL1, very similar to other oncogenic EWSR1 fusions, in particular rearrangements between EWSR1 and PATZ1 37,38 . This indicates aberrant recruitment of the TAD of EWSR1 to the DNA binding domain of PLAGL1 with subsequent downstream effects, as described for other EWSR1 rearrangements, as the likely oncogenic function of this fusion 39 .…”

Section: Discussionmentioning

confidence: 99%

Recurrent fusions inPLAGL1define a distinct subset of pediatric-type supratentorial ependymoma

Sievers

Blume

et al. 2021

Preprint

View full text Add to dashboard Cite

Ependymomas encompass a heterogeneous group of central nervous system (CNS) neoplasms that occur along the entire neuroaxis. In recent years, extensive (epi-)genomic profiling efforts have identified several molecular groups of ependymoma that are characterized by distinct molecular alterations and/or patterns. Based on unsupervised visualization of a large cohort of genome-wide DNA methylation data, we identified a highly distinct group of pediatric-type tumors (n = 40) forming a cluster separate from all established CNS tumor types, of which a high proportion were histopathologically diagnosed as ependymoma. RNA sequencing revealed recurrent fusions involving the pleomorphic adenoma gene-like 1 (PLAGL1) gene in 19 of 20 of the samples analyzed, with the most common fusion being EWSR1:PLAGL1 (n = 13). Five tumors showed a PLAGL1:FOXO1 fusion and one a PLAGL1:EP300 fusion. High transcript levels of PLAGL1 were noted in these tumors, with concurrent overexpression of the imprinted genes H19 and IGF2, which are regulated by PLAGL1. Histopathological review of cases with sufficient material (n = 16) demonstrated a broad morphological spectrum of largely ependymoma-like tumors. Immunohistochemically, tumors were GFAP-positive and OLIG2- and SOX10-negative. In 3/16 of the cases, a dot-like positivity for EMA was detected. Consistent with other fusion-positive ependymal groups, all tumors in our series were located in the supratentorial compartment. Median age of the patients at the time of diagnosis was 6.2 years. Analysis of time to progression or recurrence revealed survival times comparable to those of patients with ZFTA:RELA-fused ependymoma. In summary, our findings suggest the existence of a novel group of supratentorial ependymomas that are characterized by recurrent PLAGL1 fusions and enriched for pediatric patients.

show abstract

“…Breakpoints of the identified gene fusions were validated by RT‐PCR and Sanger sequencing, using the following primers: GOLGA4 ‐ex12F (GCTAAGCTACAGAAGCTTC), LRRFIP2 ‐ex11F (CCAGGAATGATGGCACAGTGG), CLIP1 ‐ex17F (GAAAGCCAGGTATGAGAGAG), and RAF1 ‐ex9R (GTTGGGCTCAGATTGTTGGG) (see supplementary material, Figure S1). Read alignment and variant calling were carried out as previously described [26].…”

Section: Methodsmentioning

confidence: 99%

RAF1 gene fusions are recurrent driver events in infantile fibrosarcoma‐like mesenchymal tumors

Motta,

Barresi,

Pizzi

et al. 2024

The Journal of Pathology

View full text Add to dashboard Cite

Infantile fibrosarcomas (IFS) and congenital mesoblastic nephroma (CMN) are rare myofibroblastic tumors of infancy and early childhood commonly harboring the ETV6::NTRK3 gene fusion. IFS/CMN are considered as tumors with an ‘intermediate prognosis’ as they are locally aggressive, but rarely metastasize, and generally have a favorable outcome. A fraction of IFS/CMN‐related neoplasms are negative for the ETV6::NTRK3 gene rearrangement and are characterized by other chimeric proteins promoting MAPK signaling upregulation. In a large proportion of these tumors, which are classified as IFS‐like mesenchymal neoplasms, the contributing molecular events remain to be identified. Here, we report three distinct rearrangements involving RAF1 among eight ETV6::NTRK3 gene fusion‐negative tumors with an original histological diagnosis of IFS/CMN. The three fusion proteins retain the entire catalytic domain of the kinase. Two chimeric products, GOLGA4::RAF1 and LRRFIP2::RAF1, had previously been reported as driver events in different cancers, whereas the third, CLIP1::RAF1, represents a novel fusion protein. We demonstrate that CLIP1::RAF1 acts as a bona fide oncoprotein promoting cell proliferation and migration through constitutive upregulation of MAPK signaling. We show that the CLIP1::RAF1 hyperactive behavior does not require RAS activation and is mediated by constitutive 14‐3‐3 protein‐independent dimerization of the chimeric protein. As previously reported for the ETV6::NTRK3 fusion protein, CLIP1::RAF1 similarly upregulates PI3K‐AKT signaling. Our findings document that RAF1 gene rearrangements represent a recurrent event in ETV6::NTRK3‐negative IFS/CMN and provide a rationale for the use of inhibitors directed to suppress MAPK and PI3K‐AKT signaling in these cancers. © 2024 The Pathological Society of Great Britain and Ireland.

show abstract

Expanding the spectrum of EWSR1‐PATZ1 rearranged CNS tumors: An infantile case with leptomeningeal dissemination

Cited by 13 publications

References 9 publications

Recurrent fusions in PLAGL1 define a distinct subset of pediatric-type supratentorial neuroepithelial tumors

Recurrent fusions in PLAGL1 define a distinct subset of pediatric-type supratentorial neuroepithelial tumors

Recurrent fusions inPLAGL1define a distinct subset of pediatric-type supratentorial ependymoma

RAF1 gene fusions are recurrent driver events in infantile fibrosarcoma‐like mesenchymal tumors

Contact Info

Product

Resources

About