Expressed sequence tag analysis of adult Clonorchis sinensis, the Chinese liver fluke

Abstract

Expressed sequence tag (EST) pools represent partial profiles of the gene expressions of organisms. In an effort to construct a Clonorchis sinensis EST pool, 2,387 ESTs were collected from an adult C. sinensis cDNA library and assembled into 1,573 clusters. Of these clusters, 1,225 ESTs (51%) were singletons and 348 clusters consisted of more than two ESTs. There were 848 clusters (54%) that shared significant identity with previously reported proteins, and of these, 401 clusters were categorized into 11 major functional protein classes. Three cDNA clones of fructose-1,6-bisphosphate (FBP) aldolase were selected from the C. sinensis EST pool and analyzed for phylogenic clustering. FBP clones encoded a complete polypeptide, which shared significant identity to those of vertebrate and invertebrate animals and clustered with those of trematodes. We believe that the EST pool described can be confidently used as a platform in multigene researches on C. sinensis gene expression.

Partner proteins that interact with Clonorchis sinensis WD40-repeat protein

“…Total RNA was isolated by CsCl ultracentrifugation as described previously (Cho et al 2006), and first strand cDNA was synthesized from mRNA using oligo(dT) primer and reverse transcriptase (PowerScriptTM, Clontech, Palo Alto, CA). SMART VI (5′-AAG CAGTGGTAATCAACGCAGAGTGGGAATTCCGGC CGGG-3′) primer was then annealed to the deoxycytidine stretch synthesized at 3′ end of the first strand cDNA by terminal transferase activity of the reverse transcriptase.…”

The Phylogeny, Structure and Function of Trematode Cysteine Proteases, with Particular Emphasis on the Fasciola hepatica Cathepsin L Family

“…[10][11][12] Cysteine proteases make up a large proportion of the total transcripts of each of trematode parasites studied to date. For example, nearly 15% of the transcripts derived from adult F. hepatica (http://www.sanger.ac.uk/Projects/Helminths/), 13 10% from adult C. sinensis, 14,15 as well as 18% and 27% from adult diploid and triploid P. westermani, respectively, 16 encode cysteine proteases. Cathepsin L, F and B proteases are often found DPRQJ WKH SUR¿OH RI PROHFXOHV VHFUHWHG E\ WUHPDWRGHV WHUPHG WKHLU VHFUHWRPH DOVR known as excretory-secretory proteins; ES), which allows them to perform a number of critical extracellular roles in parasite-host interactions.…”

Functional Genes and Proteins of Clonorchis sinensis

“…Analyses of the expressed sequence tags (ESTs) of C. sinensis have revealed that proteases constitute a large proportion of the protein population of the flukes [8,9], which implies their physiological significance. The cysteine proteases of C. sinensis are developmentally regulated and are essential for fluke survival in terms of the contributions they make to biological processes, such as, stage transition, nutrient uptake, and immune evasion [64,65].…”

“…A total of 3,221 ESTs of C. sinensis has been registered in public dbEST databases (http://www.ncbi.nlm.nih.gov/dbEST); 2,802 ESTs from the adults and 415 from the metacercariae [8,9,20]. In adult C. sinensis, the genes abundantly expressed in decreasing order were; groups of metabolic enzymes, regulatory and signal proteins, structure and cytoskeletal proteins, transcription and translation machinery proteins, and proteases and inhibitors.…”

“…In C. sinensis, expressed sequence tags were collected from the adults and metacercariae, and annotated and analyzed by referring to the transcriptome and genome information of Schistosoma mansoni, Schistosoma japonicum, and Opisthorchis viverrini and to genetic databases in the public domain [8][9][10][11][12]. Genetic information on functional genes at the transcriptome level can provide important practical information to proteomic researches and enable comprehensive life phenomena of C. sinensis to be elucidated by high throughput microarray analyses.…”