Expression analysis of gene trap lines and mapping of donor loci for Dissociation transposition in Arabidopsis

Kato

et al. 2008

Self Cite

Gene regulation in eukaryotes is affected by chromatin structure. Changes in chromatin structure are regulated by multiple ways of histone modifications, such as acetylation, methylation, and ubiquitination. It is believed that the trimethylated histone H3 at lysine 4 (H3K4), 36 (H3K36) and 79 (H3K79) are hallmarks of active chromatins (Shilatifard 2006). In yeast, trimethylation of H3K4 in the 5Ј region of the target gene is catalyzed by the SET1 histone methyltransferase, and the recruitment of SET1 protein requires the RNA polymerase II-associated factor 1 (PAF1) complex together with serine-5 phosphorylation of the C-terminal domain of RNA polymerase II (Hampsey and Reinberg 2003). The yeast PAF1 complex consists of five components, PAF1, LEO1, RTF1, CTR9 and CDC73 Krogan et al. 2003;Squazzo et al. 2002), and the PAF1 complex is required for efficient transcription elongation by RNA polymerase II (Marton and Desiderio 2008). Moreover, the PAF1 complex may regulate gene expression through a posttranscriptional mechanism, such as 3Ј-processing of premRNAs (Mueller et al. 2004;Penheiter et al. 2005;Sheldon et al. 2005). In human, hSki8 was identified as another component of the human PAF1 complex (Zhu et al. 2005). Human hSki8 subunit is the homolog of yeast SKI8/REC103 (Gardiner et al. 1997) that is a component of yeast superkiller (SKI) complex, which is required for 3Ј-to-5Ј degradation of cytoplasmic mRNAs (Masison et al. 1995;Anderson and Parker 1998). Human hSKI complex localizes to both nucleus and cytoplasm and interacts with human PAF1 complex, and associates with transcriptionally active genes depending on the presence of human PAF1 complex (Zhu et al. 2005). Thus, in addition to coordinating events during transcription, hPAF1 complex also coordinates events in RNA quality control.In Arabidopsis thaliana, growing evidences indicate that the major floral repressor FLOWERING LOCUS C (FLC), a MADS-box transcription factor, is under the control of multiple chromatin modifiers. It show early flowering phenotype, as well as other pleiotropic developmental defects. Here, we provide evidence that seeds with vip6/elf8 homozygous mutations were rarely obtained in all three independent lines of T-DNA insertion. Although viable seeds with homozygous mutant alleles were rarely obtained, they showed pleiotropic phenotype like mutants of other PAF1-related genes, and were sterile. These results suggest that the VIP6/ELF8 gene is essential for plant development.Key words: CTR9, ELF8, embryonic lethality, PAF1 complex, VIP6.Plant Biotechnology 25, 447-455 (2008) (He et al. 2004;Oh et al. 2004;Xu et al. 2008). Consistent with this, trimethylation of H3K4 in FLC as well as in FLOWERING LOCUS M (FLM)/MAF1 chromatin was reduced in elf7 and elf8 mutants (He et al. 2004). Similarly, decreased levels of trimethyl-H3K4 in FLC and FLM/MAF1 chromatins were observed in vip4 mutants (Xu et al. 2008).Arabidopsis vip2/elf7, vip3, vip4, vip5 and vip6/elf8, show similar phenotypes of pleiotropic developmental defects that ar...

show abstract

Section: Identification Of Mutant Alleles In Arabidopsis At2g06210 Gementioning

confidence: 99%

Section: Identification Of Kg6249mentioning

confidence: 99%

Arabidopsis VIP6/ELF8, the homolog of CTR9 component of the transcriptional complex PAF1, is essential for plant development

Shiraya

Kato

et al. 2008

Self Cite

show abstract

“…Genomic fragments of about 3.7 kb of the five ABCF subfamily members, including putative promoter regions, 5Ј untranslated regions and the first two codons (AtABCF1 promoter: 3736 bp, AtABCF2 promoter: 3741 bp, AtABCF3 promoter: 3716 bp, AtABCF4 promoter: 3866 bp, AtABCF5 promoter: 3746 bp) were fused to the GUS reporter gene of the vector pBI101, and these constructs were introduced into wild type Arabidopsis. The T2 generations of transgenic lines were germinated on 0.8% agar plates containing 0.5X B5 medium (pH 5.7), 1% (w/v) sucrose and kanamycin (25 mg ml Ϫ1 ), and GUS activity was analyzed in 20-day-old seedlings as previously reported (Kato et al 2007). After three more weeks in the growth chamber, GUS activity in flowers and siliques was also analyzed.…”

mentioning

confidence: 99%

“…To gain more insight into the function of the ABCF subfamily, we screened for knockout lines of the ABCF genes from our Arabidopsis T-DNA-tagged lines (Kato et al 2007). We made primers for each gene to screen for knockout lines (AtABCF1-f; AGATCTACAGATCTC-CCGAATC, AtABCF1-r; CTTAGCATGTGACCCCAA-TCTG, AtABCF2-f; ACCAACAATGGTATTAACG-ACG, AtABCF2-r; AGCTATGTGTGAACTGTGAAGC, AtABCF3-f; TTGGTAAGTAACCATTCGCAGC, AtABCE3-r; TGCTCGATTCGAAGATTTGGG, AtABCF4-f; ATGGGTAAGAAGAAGTCAGACG, AtABCF4-r; AACTTCACTCATCAACTTCTGC, AtABCF5-f; TCGAGGGTTTCTTACTCTGCTG, AtABCF5-r; TGTTCAGTTCCATCTCTTGGAG).…”

mentioning

confidence: 99%

Analyses of expression and phenotypes of knockout lines for Arabidopsis ABCF subfamily members

Kato

Tabata

2009

Self Cite

“…From about 20,000 gene trap lines, we first screened the 51 lines which showed GUS expression exclusively within stamens (Kato et al 2007). …”

mentioning

confidence: 99%

Gene trap strategy, an effective tool for identification of novel genes expressed in anther tissues in Arabidopsis thaliana

Ariizumi

Kawanabe

et al. 2008

Self Cite