Expression and bioactivities of endothelin‐1 in gingiva during cyclosporine A treatment

Abstract

Based on the present findings, we suggest that: (1) CsA upregulates the gingival expression of ET-1 and its receptors; and (2) ET(A) and ET(B) have different bioactivities, ET(A) being involved in cell proliferation and ET(B) being associated with iNOS expression.

Cyclosporine A-induced acute hepatotoxicity in guinea pigs is associated with endothelin-mediated decrease in local hepatic blood flow

“…CsA has been shown to increase the synthesis of ET-1 and ET receptors in several tissues (Chin et al 2009;Langman and Yatscoff 1994;Meyer-Lehnert et al 1997;Papachristou et al 2010;Tack et al 1997). Therefore, ET-1 is more likely to contribute to the hepatotoxic effect of CsA.…”

Carvacrol Ameliorates Ligation‐Induced Periodontitis in Rats

“…PCR primer sequences used in the present study were: IL‐1β, forward 5′‐GACCTGTTCTTTGAGGCTGA‐3′ and reverse 5′‐TCCATCTTCTTCTTTGGGTATTGTT‐3′; 27 TNF‐α, forward 5′‐CAGACCCTCACACTCAGATCATCTT‐3′ and reverse 5′‐CAGAGCAATGACTCCAAAGTAGACCT‐3′; 28 IL‐6, forward 5′‐GACTGATGTTGTTGACAGCCACTGC‐3′ and reverse 5′‐TAGCCACTCCTTCTCTGTGACTCTAACT‐3′; 29 inducible nitric oxide synthase (iNOS), forward 5′‐CATTGCATTCAGATCCCGA‐3′ and reverse 5′‐GGGAGGGGTAGTGATGT‐3′; 30 and GAPDH, forward 5′‐TGCTGGTGCTGAGTATGTCG‐3′ and reverse 5′‐ATTGAGAGCAATGCCAGCC‐3′ 29 . Amplified RT‐PCR products were analyzed using 1% agarose gels and visualized using ethidium bromide staining with the help of a camera system ‡‡‡ .…”

The cytokine-cosmc signaling axis upregulates the tumor-associated carbohydrate antigen Tn

“…100-05-032). The methods of inducing atherosclerosis [ 51 ], bronchitis [ 52 ] and periodontotitis [ 53 ] are described previously.…”