Expression and Modulation of RPE Cell Membrane Complement Regulatory Proteins

Yang, Ping; Tyrrell, Jillian; Han, Ian C.; Jaffe, Glenn J.

doi:10.1167/iovs.08-3202

Cited by 74 publications

(69 citation statements)

References 47 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…However, such factors, in conjunction with aging, environmental influences, and genetic predisposition could play a role in promoting the susceptibility of RPE cells to directed or bystander complement attack in vivo. We do not find evidence for RPE-directed complement attack (i.e., C5b-9 complexes associated with the RPE cell surface), most likely because the cells are chronologically young (derived from fetal sources), express membrane-associated negative regulators of complement including CD46, CD55, and CD59 (15,31,32), and have not been affected by senescence or exposed to environmental "stressors. "…”

Section: Discussionmentioning

confidence: 64%

Cell culture model that mimics drusen formation and triggers complement activation associated with age-related macular degeneration

Johnson

Forest

Banna

et al. 2011

Proc. Natl. Acad. Sci. U.S.A.

180

186

View full text Add to dashboard Cite

We introduce a human retinal pigmented epithelial (RPE) cell-culture model that mimics several key aspects of early stage age-related macular degeneration (AMD). These include accumulation of sub-RPE deposits that contain molecular constituents of human drusen, and activation of complement leading to formation of deposit-associated terminal complement complexes. Abundant sub-RPE deposits that are rich in apolipoprotein E (APOE), a prominent drusen constituent, are formed by RPE cells grown on porous supports. Exposure to human serum results in selective, deposit-associated accumulation of additional known drusen components, including vitronectin, clusterin, and serum amyloid P, thus suggesting that specific proteinprotein interactions contribute to the accretion of plasma proteins during drusen formation. Serum exposure also leads to complement activation, as evidenced by the generation of C5b-9 immunoreactive terminal complement complexes in association with APOE-containing deposits. Ultrastructural analyses reveal two morphologically distinct forms of deposits: One consisting of membrane-bounded multivescicular material, and the other of nonmembrane-bounded particle conglomerates. Collectively, these results suggest that drusen formation involves the accumulation of sub-RPE material rich in APOE, a prominent biosynthetic product of the RPE, which interacts with a select group of drusen-associated plasma proteins. Activation of the complement cascade appears to be mediated via the classical pathway by the binding of C1q to ligands in APOE-rich deposits, triggering direct activation of complement by C1q, deposition of terminal complement complexes and inflammatory sequelae. This model system will facilitate the analysis of molecular and cellular aspects of AMD pathogenesis, and the testing of new therapeutic agents for its treatment.A ge-related macular degeneration (AMD) is characterized in its early stages by the presence of extracellular deposits, known as drusen, that accumulate between the basal surface of the retinal pigmented epithelium (RPE) and Bruch's membrane, an extracellular matrix complex that separates the neural retina from the capillary network in the choroid. Early electron microscopic studies suggested that drusen formation may be a consequence of degeneration of the RPE (1-3), initiated by membranous debris shed from its basal surface (4, 5). These early morphological observations have since been confirmed by a number of more recent studies (6-13).Contemporary investigations of the molecular composition of drusen have provided additional insights into their biogenesis. Immunohistochemical and proteomic studies show that drusen contain a variety of protein and lipid components (14, 15). Among these are several plasma proteins, the presence of which implies a systemic contribution to their genesis. Although the primary biosynthetic source for most of these circulating molecules is the liver, a number of them are also known to be synthesized locally by RPE cells (15)(16)(17)(18)(19). The respect...

show abstract

Section: Discussionmentioning

confidence: 64%

Cell culture model that mimics drusen formation and triggers complement activation associated with age-related macular degeneration

Johnson

Forest

Banna

et al. 2011

Proc. Natl. Acad. Sci. U.S.A.

180

186

View full text Add to dashboard Cite

show abstract

“…Quantitative real-time PCR (qRT-PCR) was done on a DNA Engine Opticon2 (MJ Research-Bio-Rad) using a two-step kit with SYBR Green (Invitrogen) and mouse gene-specific primer sets for complement regulator protein and oxidative stress genes DAF1 (NM_010016.2, AATGCGAGGGGAAAGTGAC (forward) and TGAGGGGGTTCCTGTACTTG (reverse)), DAF2 (NM_007827.2, GTCATCACCACCACTGCTGCTG (forward) and ATTAGGAATGTCTGGAGGTGGGC (reverse)), CRRY (NM_013499.2, CCAGCAGTGTGCATTGTCA-GTCC (forward) and CCCCTTCTGGAATCCACTCATCTC (reverse)), CD59a (NM_001111060.1, GAGCATGAGCACA-GTCACTGGCG (forward) and GAACACAGCC-AGAAGCAGCAGGAG (reverse)), CD59b (NM_181858.1, GAGCCAAACAACGCAGAAACTTCC (forward) and GGG-CATCCAGGATGACTTAGAAGC (reverse)), CFH (NM_ 009888.3, ACCACATGTGCCAAATGCTA (forward) and TGTTGAGTCTCGGCACTTTG (reverse)) (38), MCP-1 (NM_011333.3, AGGTCCCTGTCATGCTTCTG (forward) and TCTGGACCCATTCCTTCTTG (reverse)), glutathione S-transferase (NM_008185.3, TGTACCTGGATCTG-CTGTCG (forward) and TGTGTGCCAGGTAGAGCAAG (reverse)), glutathione S-transferase mu (NM_010358.5, AGA-ACCAGGTCATGGACACC (forward) and ACTTGGGCTC-AAACATACGG (reverse)), SOD1 (NM_011434.1, GAGACC-TGGGCAATGTGACT (forward) and GTTTACTGCGCAA-TCCCAAT (reverse)), catalase-1 (CAT1, NM_009804.2, ACA-TGGTCTGGGACTTCTGG (forward) and CAAGTTTTTG-ATGCCCTGGT (reverse)), and heme oxygenase-1 ((forward) GCATGCCCCAGGATTTGTC and CTGGCCCTTCTGAA-AGTTCCTCATG (reverse) (39)) or human gene specific primer sets CD46 (NM_002389.4, CCAAAGTGTCTTAAAG-TGCTGCCTC (forward) and CTAGGACCTGAGGCACTG-GACG (reverse)), CD55 (NM_000574.3, AGGCATTTTCAT-CTTTCCTTCGGG (forward) and CCTTATCACCATCAAC-ACCCCTGG (reverse)), CD59 (NM_000611.5, GAGCCCAG-GGAGGGAAAGGTTC (forward) and CGAGGTTAAGGCA-AAACCCTACGG (reverse)) (38), CFH (NM_000186.3, CAG-CAGTACCATGCCTCAGA (forward) and GGATGCATCT-GGGAGTAGGA (reverse)), glutathione S-transferase mu (NM_000561.3, ATGCCCATGATACTGGGGTA (forward) and GTGAGCCCCATCAATCAAGT (reverse)), SOD1 (NM_000454.4, AGGGCATCATCAATTTCGA (forward) and ACATTGCCCAAGTCTCCAAC (reverse)), heme oxygenase-1 (NM_002133.2, TCCGATGGGTCCTTACACTC (forward) and TAAGGAAGCCAGCCAAGAGA (reverse)), and CAT1 (NM_001752.3, AGCTTAGCGTTCATCCGTGT (forward) and TCCAATCATCCGTCAAAACA (reverse)). Both mouse and human cDNA templates were normalized to 18 S rRNA using the same primers set (NR_003278.1, (forward) TT-TGTTGGTTTTCGGAACTGA and (reverse) CGTTTATGG-TCGGAACTACGA).…”

Section: Mouse Ros Preparation-balb/c and Abca4mentioning

confidence: 99%

Complement System Dysregulation and Inflammation in the Retinal Pigment Epithelium of a Mouse Model for Stargardt Macular Degeneration

Radu¹,

Hu²,

Yuan³

et al. 2011

Journal of Biological Chemistry

142

152

View full text Add to dashboard Cite

show abstract

“…6,7 The formation of MAC is regulated by the membrane bound complement regulatory protein CD59, which controls activation of complement by inhibiting the incorporation of C9 into the forming complex, and thereby preventing assembly of a functional pore. 8,9 CD59 is strongly expressed in the normal human retina and in cultured retinal pigment epithelial (RPE) cells. 10 AMD pathogenesis was shown to be associated with several inflammatory indicators, like an increase in white blood cell count, C-reactive protein levels, and intercellular adhesion molecule-1 amongst others.…”

Section: Introductionmentioning

confidence: 99%

Sub-lytic C5b-9 induces functional changes in retinal pigment epithelial cells consistent with age-related macular degeneration

Lueck

Wasmuth

Williams³

et al. 2011

Eye

View full text Add to dashboard Cite

Purpose There is evidence for complement dysfunction in age-related macular degeneration (AMD). Complement activation leads to formation of the membrane attack complex (MAC), known to assemble on retinal pigment epithelial (RPE) cells. Therefore, the effect of sub-lytic MAC on RPE cells was examined with regard to pro-inflammatory or pro-angiogenic mediators relevant in AMD. Methods For sub-lytic MAC induction, RPE cells were incubated with an antiserum to complement regulatory protein CD59, followed by normal human serum (NHS) to induce 5% cell death, measured by a viability assay. MAC formation was evaluated by immunofluorescence and FACS analysis. Interleukin (IL)-6, -8, monocytic chemoattractant protein-1 (MCP-1), and vascular endothelial growth factor (VEGF) were quantified by enzyme-linked immunosorbent assay (ELISA). Intracellular MCP-1 was analysed by immunofluorescence, vitronectin by western blotting, and gelatinolytic matrix metalloproteinases (MMPs) by zymography. Results Incubation of RPE cells with the CD59 antiserum followed by 5% NHS induced sub-lytic amounts of MAC, verified by FACS and immunofluorescence. This treatment stimulated the cells to release IL-6, -8, MCP-1, and VEGF. MCP-1 staining, production of vitronectin, and gelatinolytic MMPs were also elevated in response to sub-lytic MAC. Conclusions MAC assembly on RPE cells increases the IL-6, -8, and MCP-1 production.

show abstract

Expression and Modulation of RPE Cell Membrane Complement Regulatory Proteins

Abstract: Human and mouse RPE cell mCRPs are upregulated by inflammatory cytokines and repetitive nonlethal oxidant exposure in a species-specific manner. Increased cell mCRPs may help to protect RPE cells from complement- and oxidant-mediated injury in diseases such as AMD.

Cited by 74 publications

References 47 publications

Cell culture model that mimics drusen formation and triggers complement activation associated with age-related macular degeneration

Cell culture model that mimics drusen formation and triggers complement activation associated with age-related macular degeneration

Complement System Dysregulation and Inflammation in the Retinal Pigment Epithelium of a Mouse Model for Stargardt Macular Degeneration

Sub-lytic C5b-9 induces functional changes in retinal pigment epithelial cells consistent with age-related macular degeneration

Contact Info

Product

Resources

About