Expression and regulation of Lhx6 and Lhx7, a novel subfamily of LIM homeodomain encoding genes, suggests a role in mammalian head development

Abstract

LIM-homeobox containing (Lhx) genes encode trascriptional regulators which play critical roles in a variety of developmental processes. We have identified two genes belonging to a novel subfamily of mammalian Lhx genes, designated Lhx6 and Lhx7. Whole-mount in situ hybridisation showed that Lhx6 and Lhx7 were expressed during mouse embryogenesis in overlapping domains of the first branchial arch and the basal forebrain. More specifically, expression of Lhx6 and Lhx7 was detected prior to initiation of tooth formation in the presumptive oral and odontogenic mesenchyme of the maxillary and mandibular processes. During tooth formation, expression was restricted to the mesenchyme of individual teeth. Using explant cultures, we have shown that expression of Lhx6 and Lhx7 in mandibular mesenchyme was under the control of signals derived from the overlying epithelium; such signals were absent from the epithelium of the non-odontogenic second branchial arch. Furthermore, expression studies and bead implantation experiments in vitro have provided strong evidence that Fgf8 is primarily responsible for the restricted expression of Lhx6 and Lhx7 in the oral aspect of the maxillary and mandibular processes. In the telencephalon, expression of both genes was predominantly localised in the developing medial ganglionic eminences, flanking a Fgf8-positive midline region. We suggest that Fgf8 and Lhx6 and Lhx7 are key components of signalling cascades which determine morphogenesis and differentiation in the first branchial arch and the basal forebrain.

Alx1 Deficient Mice Recapitulate Craniofacial Phenotype and Reveal Developmental Basis of ALX1-Related Frontonasal Dysplasia

“…The plasmid templates of the Alx1, Gsc, and Rnf128 probes were amplified by PCR and cloned into pBSKII vector using the following primers, Alx1 F: TATACG GGGTTTTCGAACCA, Alx1 R: CACTCTGTTGCAGCCTCA AG; Gsc F: CTGTCCGAGTCCAAATCGCT, Gsc R: AGCATC GACAACATCCTGG; Pax7 F: GGGTAGGGGGCACAGAGG CA, Pax7 R: CCGGGCCAGCAGGTGGTTTC; Pitx2 F: ACA TACTCATAGATGAGATG, Pitx2 R: GAAATCAAAAAGGTC GAGTT; Rnf128 F: CAACAGGACTGCCAATCAGG, Rnf128 R: TGCACCGTAACCAGTTACCAA; Sox10 F: CGAAGCTTC CATCTCACGACCCCAGTTT, Sox10 R: CCGGATCCAGGC GAGAAGAAGGCTAGGT. The Lhx6 and Lhx8 (Grigoriou et al, 1998), andLmx1b (Liu andJohnson, 2010) probes were received from published sources.…”

A Novel LHX6 Reporter Cell Line for Tracking Human iPSC-Derived Cortical Interneurons

“…Since LHX6 is expressed in nascent postmitotic cortical interneurons [ 21 , 42 ], we tested reporter response to the modulation of cell division. As shown in Figure 3 D, we observed a decrease in the proportion of mCherry+ cells from day 35 to day 45.…”

“…Double immunostaining for SST and the pan GABAergic marker GAD67 at day 65 revealed a reduction of SST+ cells, while the total GABAergic content was comparable between the two culture conditions (Figure 4E,F). Since LHX6 is expressed in nascent postmitotic cortical interneurons [21,42], we tested reporter response to the modulation of cell division. As shown in Figure 3D, we observed a decrease in the proportion of mCherry+ cells from day 35 to day 45.…”

Identification of TGFβ signaling as a regulator of interneuron neurogenesis in a human pluripotent stem cell model

“…Interneuron differentiation is a lengthy process, typically the expression of defined interneuron subtype protein markers such as SST will not be detected until day 60 of the protocol. To facilitate the monitoring of interneuron birth, we took advantage of an LHX6-based interneuron reporter hESC line (the LHM cells) which harbors a targeted mCherry reporter in the LHX6 gene, which begins its expression in immature migrating cortical interneurons ( Figure 1 A,B) [ 13 , 24 ]. We firstly compared interneuron differentiation propensity of the LHM cells to the H7 parental hESCs.…”