Expression and Secretion of Recombinant Outer-surface Protein A from the Lyme Disease Agent, Borrelia burgdorferi, in Nicotiana tabacum Suspension Cells

Navarre, Catherine; Delannoy, Mélanie; Lefebvre, Benoît; Nader, Joseph; Vanham, Delphine; Boutry, Marc

doi:10.1007/s11248-006-0002-7

Cited by 11 publications

(8 citation statements)

References 40 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The sequence encoding the HA ectodomain (codons 18–529) was amplified from this sequence using the primers HA-Chit (5′ TATCCTCGGCCGAAGATACCCTCTGCATTGG 3′) and HA-HFBIR (5′ CGAGTGAACCACCACCCTGATAGATCCTGGTACTC 3′). This was fused by overlap extension PCR to the signal peptide sequence (codons 1 to 21) of the Arabidopsis thaliana basic endochitinase (Accession number: P19171) amplified from pSK-chit-OspA [44] using the primers chitAgeI (5′AAC ACCGGT ATGAAGACTAATCTTTTTCTC 3′, AgeI site underlined) and Chit-HA (5′ CCAATGCAGAGGGTATCTTCGGCCGAGGATAATGAT 3′). The resulting chit-HA fragment was cloned into the pGEM-T Easy vector and sequenced.…”

Section: Methodsmentioning

confidence: 99%

Hydrophobin Fusion of an Influenza Virus Hemagglutinin Allows High Transient Expression in Nicotiana benthamiana, Easy Purification and Immune Response with Neutralizing Activity

et al. 2014

Self Cite

View full text Add to dashboard Cite

The expression of recombinant hemagglutinin in plants is a promising alternative to the current egg-based production system for the influenza vaccines. Protein-stabilizing fusion partners have been developed to overcome the low production yields and the high downstream process costs associated with the plant expression system. In this context, we tested the fusion of hydrophobin I to the hemagglutinin ectodomain of the influenza A (H1N1)pdm09 virus controlled by the hybrid En2PMA4 transcriptional promoter to rapidly produce high levels of recombinant antigen by transient expression in agro-infiltrated Nicotiana benthamiana leaves. The fusion increased the expression level by a factor of ∼2.5 compared to the unfused protein allowing a high accumulation level of 8.6% of the total soluble proteins. Hemagglutinin was located in ER-derived protein bodies and was successfully purified by combining an aqueous-two phase partition system and a salting out step. Hydrophobin interactions allowed the formation of high molecular weight hemagglutinin structures, while unfused proteins were produced as monomers. Purified protein was shown to be biologically active and to induce neutralizing antibodies after mice immunization. Hydrophobin fusion to influenza hemagglutinin might therefore be a promising approach for rapid, easy, and low cost production of seasonal or pandemic influenza vaccines in plants.

show abstract

Section: Methodsmentioning

confidence: 99%

Hydrophobin Fusion of an Influenza Virus Hemagglutinin Allows High Transient Expression in Nicotiana benthamiana, Easy Purification and Immune Response with Neutralizing Activity

et al. 2014

Self Cite

View full text Add to dashboard Cite

show abstract

“…Proteins in the cell extract (17 lg) or proteins in 100 ll of extracellular medium were precipitated using chloroform/methanol according to Wessel and Flugge (1984), then solubilized by boiling for 10 min in 16 ll of denaturation buffer (50 mM sodium citrate, pH 5.5 (HCl), 0.5% (w/v) SDS, 0.1 M b-mercaptoethanol) followed by addition of 1 ll of 10 mg/ml PMSF (in methanol) and 23 ll of citrate buffer [50 mM sodium citrate, pH 5.5 (HCl)] alone or containing 0.2 unit/ml of endoglycosidase H (ROCHE) as described by Navarre et al (2006). After incubation for 30 min at 37°C, the reaction was stopped by addition of 20 ll of 39 SDS loading buffer (see above).…”

Section: Endoglycosidase H Digestionmentioning

confidence: 99%

Different subcellular localization and glycosylation for a functional antibody expressed in Nicotiana tabacum plants and suspension cells

et al. 2009

Self Cite

View full text Add to dashboard Cite

Genes encoding the heavy and light chains of LO-BM2, a therapeutic IgG antibody, were assembled in the tandem or inverted convergent orientation and expressed in Nicotiana tabacum plants and BY-2 suspension cells. The tandem construct allowed higher expression in both expression systems. A similar degradation pattern was observed for the secreted antibody recovered from the leaf intercellular fluid and BY-2 culture medium. Degradation increased with leaf age or culture time. Antibodies purified from leaf tissues and BY-2 cells were both functional. However, MS analysis of the N-glycosylation showed complex plant-type glycans to be the major type in the antibody purified from plants, whereas, oligomannosidic was the major glycosylation type in that purified from BY-2 cells. LO-BM2 was observed mainly in the endoplasmic reticulum of BY-2 cells while, in leaf cells, it was localized mostly to vesicles resembling prevacuolar compartments. These results and those from endoglycosidase H studies suggest that LO-BM2 is secreted from BY-2 cells more readily than from leaf cells where it accumulates in a post-Golgi compartment.

show abstract

“…Analysis of the bacterial SS of OspA with TargetP [29] provided evidence that the genuine OspA SS could act as a presequence for targeting the protein to the apoplast. In fact, a previous study showed that OspA is secreted when expressed in Nicotiana tabacum suspension cells [30]. Hence, full-length OspA variants could not be detected in protoplasts.…”

Section: Production Of Ospa Variants Via a Transient Tobaccomosaic VImentioning

confidence: 95%

Assessment of Different Expression Strategies for the Production of a Recombinant Lipoprotein Vaccine in Plants

Hennig¹,

Reinders²,

Giritch³

et al. 2008

TOBIOTJ

View full text Add to dashboard Cite

Abstract:The ability of plants to serve as a production system for bacterial lipoprotein vaccines has been investigated. First, the effect of high-level expression of the Borrelia burgdorferi outer membrane protein A (OspA), a prototype vaccine against Lyme disease, has been examined by a proteomics approach. Analysis by 2D-PAGE of wild type tobacco plants and transplastomic plants accumulating recombinant OspA showed no apparent differences in protein pattern except for OspA. However, presence of the bacterial signal sequence limits transgene accumulation. As an alternative approach OspA was produced in Nicotiana benthamiana plants by transient expression via a deconstructed tobacco mosaic virus-based system. While rapid expression of OspA could be achieved, no palmitoylation occurred with the genuine bacterial sequence. In contrast, modification of the N-terminus with an eukaryotic sequence motif resulted in palmitoylation of OspA. This study shows that plants provide multiple expression strategies and could serve as a versatile production platform for recombinant lipidated subunit vaccines.

show abstract

Expression and Secretion of Recombinant Outer-surface Protein A from the Lyme Disease Agent, Borrelia burgdorferi, in Nicotiana tabacum Suspension Cells

Cited by 11 publications

References 40 publications

Hydrophobin Fusion of an Influenza Virus Hemagglutinin Allows High Transient Expression in Nicotiana benthamiana, Easy Purification and Immune Response with Neutralizing Activity

Hydrophobin Fusion of an Influenza Virus Hemagglutinin Allows High Transient Expression in Nicotiana benthamiana, Easy Purification and Immune Response with Neutralizing Activity

Different subcellular localization and glycosylation for a functional antibody expressed in Nicotiana tabacum plants and suspension cells

Assessment of Different Expression Strategies for the Production of a Recombinant Lipoprotein Vaccine in Plants

Contact Info

Product

Resources

About