Expression, crystallization, and preliminary X-ray analysis of a sialic acid-binding fragment of sialoadhesin in the presence and absence of ligand

Abstract

Abstract:Sialoadhesin is a macrophage-restricted cell surface receptor, consisting of 17 immunoglobulin domains, which mediates cell adhesion via the recognition of specific sialylated glycoconjugates. A functional fragment of sialoadhesin, comprising the N-terminal immunoglobulin domain, has been expressed in Chinese hamster ovary cells as both native (SnDI) and selenomethionyl (Se-SnD1) stop protein. The successful production of 86% selenomethionine-incorporated protein represents a rare example of production of selenium-labeled protein in mammalian cells. SnD 1 and Se-SnD 1 have been crystallized in the absence of ligand, and SnDl has also been crystallized in the presence of its ligand 2,3 sialyllactose. The ligand-free crystals of SnDl and Se-SnDI were isomorphous, of space group P3121 or P3221, with unit cell dimensions a = b = 38.9 A, c = 152.6 A, LY = p = 90°, y = 120°, and diffracted to a maximum resolution of 2.6 8. Cocrystals containing 2,3 sialyllactose diffracted to 1.85 A at a synchrotron source and belong to space group P212121, with unit cell dimensions a = 40.9 A, b = 97.6 A, c = 101.6 A, LY = p = y = 90".Keywords: cell adhesion; complex; crystallization; lectin; selenomethionine; sialic acid Sialoadhesin is a cell surface receptor that mediates cellular interactions by recognizing specific sialylated glycans in cell surface

A time- and cost-efficient system for high-level protein production in mammalian cells

“…The first report of successful labelling and structure determination of an SeMet recombinant protein expressed in mammalian cells (CHO; Lustbader et al, 1995) and subsequent simplification of the method (May et al, 1997;Davis et al, 2001) encouraged us to try applying it in our transient transfection setup using HEK293T cells.…”

Porcine Arterivirus Attachment to the Macrophage-Specific Receptor Sialoadhesin Is Dependent on the Sialic Acid-Binding Activity of the N-Terminal Immunoglobulin Domain of Sialoadhesin

“…The fact that neuraminidase treatment of the porcine arterivirus blocks infection of macrophages may indicate that sialic acids present on viral glycoproteins are important for virus interaction with Sn (7). Therefore, it was investigated in this study whether the sialic acid-binding activity of porcine Sn can be eliminated by site-directed mutagenesis and whether the absence of sialic acid-binding activity has an effect on the interaction of the porcine arterivirus with Sn.The amino acid residues critical for sialic acid-binding activity have been identified for mouse Sn by a combination of site-directed mutagenesis, nuclear magnetic resonance, and crystallography (4,18,20,27). To generate a sialic acid-binding mutant of pSn, the amino acid R 116 , which is by analogy to mouse Sn critical for the sialic acid-binding activity of pSn, was changed to an E residue by site-directed mutagenesis (QuikChange; Stratagene) of the pcDNA3.1/pSn vector (26) with the primers pSnRE_F (TCGGGCTCCTATAACTTCGA…”

“…The amino acid residues critical for sialic acid-binding activity have been identified for mouse Sn by a combination of site-directed mutagenesis, nuclear magnetic resonance, and crystallography (4,18,20,27). To generate a sialic acid-binding mutant of pSn, the amino acid R 116 , which is by analogy to mouse Sn critical for the sialic acid-binding activity of pSn, was changed to an E residue by site-directed mutagenesis (QuikChange; Stratagene) of the pcDNA3.1/pSn vector (26) with the primers pSnRE_F (TCGGGCTCCTATAACTTCGA ATTTGAGATCAGCGAGGGC) and pSnRE_R (GCCCTC GCTGATCTCAAATTCGAAGTTATAGGAGCCCGA).…”

Crystallographic and in Silico Analysis of the Sialoside-binding Characteristics of the Siglec Sialoadhesin

“…20 Briefly, SnD1 was subcloned into plasmid pEE14 and expressed stably in Chinese hamster ovary (CHO) cells as both native and selenomethionine-incorporated protein. Growth of CHO cells in L-selenomethioninecontaining medium reduced the yield relative to the native protein, but resulted in 86% overall incorporation of selenium in place of sulfur.…”