Expression of Aquaporin 1 and 5 and Their Regulation by Ovarian Hormones, Arachidonic Acid, Forskolin and cAMP During Implantation in Pigs

Abstract

Aquaporin proteins (AQPs) are a family of channels expressed in numerous mammalian tissues, where they play a fundamental role in regulating water transport across cell membranes. Based on reports that AQPs are present in the reproductive system and participate in reproductive processes, our aim was to investigate the effect of progesterone (P4), estradiol (E2), oxytocin (OT), arachidonic acid (AA), forskolin (FSK) and cyclic adenosine monophosphate (cAMP) on AQP1 and AQP5 expression at mRNA and protein levels in porcine uterine explants from Days 14-16 of gestation in order to determine if they play a role in implantation period in pigs. Quantitative real time PCR and Western-blot analysis revealed that the uterine explants treated with FSK and cAMP produce delayed, but long-term effects on AQP1 abundance (24 h) while AQP5 had a rapid and sustained response to FSK and cAMP in protein content (3 and 24 h). AA increases gene and protein content of AQP1 after longer exposition whereas AQP5 increases after 3 h only at the protein level. Both AQPs potentially remains under control of steroid hormones. OT has been shown to increase AQP1, and decrease AQP5 mRNA, without visible changes in protein content. P4, E2, AA, FSK and cAMP caused the appearance of AQP5 expression in the basolateral plasma membrane of the epithelial cells. The staining represents most likely AQP5 functioning mechanism for both absorption and reabsorption across the glandular epithelium.

N-Glycanase 1 Transcriptionally Regulates Aquaporins Independent of Its Enzymatic Activity

“…supporting our results. This result is consistent with previous studies showing that the cyclic AMP/CREB pathway is involved in regulating expression of AQP5 in nasal epithelium cells (Wang and Zheng, 2011) and lung epithelial cells (Yang et al, 2003); expression of AQP1, 8, and 9 in human amnion epithelia (Shengbiao Wang et al, 2007); and AQP1 and 5 in porcine uterine explants (Skowronska et al, 2016). A previous study has implicated NGLY1's role in activating another transcription factor, NFE2L1 (NRF1).…”

Pituitary Gonadotropins, Prolactin and Growth Hormone Differentially Regulate AQP1 Expression in the Porcine Ovarian Follicular Cells

“…They stimulate follicular cell proliferation and, together with FSH, initiate the formation of LH receptors in granulosa cells, mainly in the mural, progesterone and androgen production in theca interna cells [ 37 , 38 ]. A thorough discussion regarding the influence of steroid hormones on aquaporins in the female reproductive system has been already presented in our previous papers [ 39 , 40 , 41 ]. In turn, very interesting results on transgenic mice deficient in AQP proteins showed different reproductive phenomena in both males and females [ 42 , 43 , 44 , 45 ].…”

“…Quantitative Real-Time PCR was used to establish dynamic changes in Aqp1 mRNA expression. The following primers sequences were used [ 40 , 41 ]: Aqp1 forward CAGCGAGTTCAAGAAGAAG, Aqp1 reverse GCGACACCTTCACGTTATC, GAPDH forward GACCTCCACTACATGGTCTA, GAPDH reverse AAGATGGTGATGGCCTTTC, PPIA forward GCACTGGTGGCAAGTCCAT and PPIA reverse AGGACCCGTATGCTTCAGGA (access No. : AY266299) available in GeneBank, this study.…”

Expression of Selected Connexin and Aquaporin Genes and Real‐Time Proliferation of Porcine Endometrial Luminal Epithelial Cells in Primary Culture Model

“…In our research, we only observe proteins responsible for the transport in cells without additional hormonal stimulation. Hence, we can observe the potential of cells to express individual proteins [30,33].…”