Expression of biologically active heterodimeric bovine follicle-stimulating hormone in milk of transgenic mice.

Abstract

Follicle-stimulating hormone (FSH; follitropin) is a pituitary glycoprotein composed of two posttranslationally modified subunits, which must properly assemble to be biologically active. FSH has been difficult to purify and to obtain in quantities sufficient for detailed biochemical studies. We have targeted FSH expression to the mammary gland of transgenic mice by using cDNAs encoding the bovine a and FSHP subunits and a modified rat f-casein gene-based expression system. Lines of bigenic mice expressing both subunits have been generated either by coinection of the subunit transgenes or by mating mice that acquired and expressed transgenes encoding an individual subunit. Up to 60 international units (15 ,sg) of biologically active FSH per ml was detected in the milk of the bigenic mice. These lines provide a model system for studying the post-transcriptional mechanisms that effect the expression and secretion of this heterodimeric hormone.Follicle-stimulating hormone (FSH; follitropin) is a member of the glycoprotein family of pituitary hormones, which includes thyroid-stimulating hormone (TSH), luteinizing hormone (LH), and chorionic gonadotropin (CG). Like LH and CG, FSH is a gonadotropin and is composed of a common a subunit that is noncovalently linked to a hormone-specific P subunit (1, 2). FSH has been difficult to purify and to obtain in sufficient quantities for detailed biochemical studies (for a review, see ref. 3). The a and FSHI subunits are posttranslationally modified, and the nature and extent of such modifications can exert a profound effect on subunit assembly, secretion, and stability (4-6). Only heterodimers with appropriately glycosylated subunits exhibit significant biological and receptor-binding activity (5,7,8). Targeting FSH to the mammary gland of transgenic animals would, therefore, serve as a model system in which to study glycoprotein processing and secretion as well as a means to produce large quantities of FSH. A standardized source of recombinant FSH would be useful to both human and livestock fertilization programs to achieve the reproducible development of ovarian follicles.Several different milk protein-based constructs have been employed to express diverse heterologous proteins in the milk of a variety of transgenic animals (for reviews, see refs. 9-11). We have demonstrated previously that a -524/+490 minimal rat f3-casein promoter fragment can direct the expression of chloramphenicol acetyltransferase to the mammary gland (12). To determine whether the mammary gland could be used to secrete large quantities of a bioactive heterodimeric protein into milk, we have used a modified rat ,8-casein-based vector to target and express bovine FSH (bFSH) to the mammary gland and into the milk of transgenic mice. MATERIALS AND METHODSConstruction of the Transgenes. The FSH subunit cDNAs were obtained from Genzyme; a as a 730-base-pair (bp) EcoRI fragment and FSH(3 as a 560-bp EcoRI/BamHI fragment. The cDNA fragments were inserted into pUC19 (13) with the rat 13-casein -524/+49...

Expression and secretion of a biologically active glycoprotein hormone, ovine follicle stimulating hormone, by Pichia pastoris

“…Biologically active recombinant FSH has been produced previously using transformed mammalian and insect cell lines and transgenic mice (Keene et al 1989, Greenberg et al 1991, Mountford et al 1994, Arey et al 1997, Hakola et al 1997). The CHO cell-derived recombinant human FSH has been used successfully in infertility treatment (Devroey et al 1993).…”

High-level expression of the rat whey acidic protein gene is mediated by elements in the promoter and 3' untranslated region.

“…The microinjection and transfer of mouse embryos were carried out as described previously, as was the isolation of genomic tail DNA (24). Initial characterization of transgenic lines was performed by amplification of tail DNA by the polymerase chain reaction (PCR), essentially as described previously (15). The oligonucleotides used were specific for rat WAP and were made to the first exon and the 3'-flanking region, resulting in a 2-kb product (5' primer [5' to 3'], ATGTCGA CATCAGTCATCACTTGCCTGCCGCCG; 3' primer [5' to 3'], GAGGTACCTCATTCTGTCAAGAGCTCAGGACAG).…”

High-level expression of biologically active recombinant bovine follicle stimulating hormone in a baculovirus system

“…There is considerable evidence that the untranslated 3 region of the mRNA of the bFSH -subunit that we used can influence stability of the mRNA, and may thus have contributed to the secretion of a high concentration of bioactive rbFSH into the medium. FSH -subunit biosynthesis is probably a rate-limiting step in FSH heterodimer assembly and secretion (Greenberg et al 1991). Furthermore, it has been suggested by Keene et al (1989) that the unusually  5 SDS-PAGE (12% acrylamide, non-reducing conditions) of immunoaffinity-purified rbFSH fractions 15, 16 and 17, followed by silverstaining (A) or western blotting (B).…”

“…Recombinant FSH has been produced in mammalian systems such as chinese hamster ovary (CHO) cells for the human (Keene et al 1989, Van Wezenbeek et al 1990, Cerpa-Poljak et al 1993, Roth et al 1993, ovine (Mountford et al 1994) and rat (Hakola et al 1997) species, whereas for the bovine species it has been produced in mouse epitheloid cells (Chappel et al 1988), CHO cells and transgenic mice (Greenberg et al 1991).…”