Expression of Cre recombinase during transient phage infection permits efficient marker removal in Streptomyces

Khodakaramian, Gholam

doi:10.1093/nar/gnj019

Cited by 35 publications

(34 citation statements)

References 18 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…This was then used to insert the apramycin (Apr) resistance cassette aacC4 flanked by loxP sites, using engineered XbaI sites. The presence of the loxP recognition sites allows the efficient removal of the apramycin resistance cassette following the introduction of plasmid pUWLcre (expressing the Cre recombinase) (30,31). We constructed the knockout plasmids pGAM8 to pGAM14 for the single gene replacement of SCO0794, SCO1060, SCO2846, SCO6008, SCO6566, SCO6600, SCO7543, respectively.…”

Section: Methodsmentioning

confidence: 99%

The ROK Family Regulator Rok7B7 Pleiotropically Affects Xylose Utilization, Carbon Catabolite Repression, and Antibiotic Production in Streptomyces coelicolor

Świątek

Gubbens

Bucca

et al. 2013

Journal of Bacteriology

View full text Add to dashboard Cite

cMembers of the ROK family of proteins are mostly transcriptional regulators and kinases that generally relate to the control of primary metabolism, whereby its member glucose kinase acts as the central control protein in carbon control in Streptomyces. Here, we show that deletion of SCO6008 (rok7B7) strongly affects carbon catabolite repression (CCR), growth, and antibiotic production in Streptomyces coelicolor. Deletion of SCO7543 also affected antibiotic production, while no major changes were observed after deletion of the rok family genes SCO0794, SCO1060, SCO2846, SCO6566, or SCO6600. Global expression profiling of the rok7B7 mutant by proteomics and microarray analysis revealed strong upregulation of the xylose transporter operon xylFGH, which lies immediately downstream of rok7B7, consistent with the improved growth and delayed development of the mutant on xylose. The enhanced CCR, which was especially obvious on rich or xylose-containing media, correlated with elevated expression of glucose kinase and of the glucose transporter GlcP. In liquid-grown cultures, expression of the biosynthetic enzymes for production of prodigionines, siderophores, and calcium-dependent antibiotic (CDA) was enhanced in the mutant, and overproduction of prodigionines was corroborated by matrixassisted laser desorption ionization-time-of-flight analysis. These data present Rok7B7 as a pleiotropic regulator of growth, CCR, and antibiotic production in Streptomyces.

show abstract

Section: Methodsmentioning

confidence: 99%

The ROK Family Regulator Rok7B7 Pleiotropically Affects Xylose Utilization, Carbon Catabolite Repression, and Antibiotic Production in Streptomyces coelicolor

Świątek

Gubbens

Bucca

et al. 2013

Journal of Bacteriology

View full text Add to dashboard Cite

show abstract

“…The phoR gene is located on cosmid 7H10 (Fernández-Martínez et al 2011). pIJ774 (Khodakaramian et al 2006) was used as the template in a PCR since it contains the loxP sites flanking the apramycin resistance 110 cassette, thus allowing its posterior removal using the Cre-loxP system. To amplify pIJ774,primersCAR01(TGGGGCCGGACGGTTCGCCGTGCCTAACCTGGAGACAT GATTCCGGGGATCCGTCGACC) and phoRrev (AGTCCGGCGCGGTCGGACCGCC GCTGCGCGCGGTCGCGGTGTAGGCTGGAGCTGCTTC) were used to generate the recombination substrate for replacement of phoR in cosmid 7H10.…”

Section: Construction Of a Non-polar S Coelicolor ∆Phor Mutant 105mentioning

confidence: 99%

Is PhoR–PhoP partner fidelity strict? PhoR is required for the activation of the pho regulon in Streptomyces coelicolor

2012

View full text Add to dashboard Cite

show abstract

“…The bacteriophage P1 derived Cre-loxP system has been adapted to gram-positive bacteria such as Corynebacterium glutamicum (44), mycobacteria (40), Streptomyces coelicolor (24), B. anthracis (36), Lactobacillus plantarum (26), or Lactococcus lactis (11) but has, to our knowledge, thus far remained untapped for the biotechnologically and medically important genus of staphylococci. We aimed to establish this technology in these bacteria primarily for marker excision purposes.…”

Section: Discussionmentioning

confidence: 99%

Marker Removal in Staphylococci via Cre Recombinase and Different lox Sites

Leibig

Krismer

Kolb

et al. 2008

Appl Environ Microbiol

View full text Add to dashboard Cite

Allelic replacement in staphylococci is frequently aided by antibiotic resistance markers that replace the gene(s) of interest. In multiply modified strains, the number of mutated genes usually correlates with the number of selection markers in the strain's chromosome. Site-specific recombination systems are capable of eliminating such markers, if they are flanked by recombinase recognition sites. In this study, a Cre-lox setting was established that allowed the efficient removal of resistance genes from the genomes of Staphylococcus carnosus and S. aureus. Two cassettes conferring resistance to erythromycin or kanamycin were flanked with wild-type or mutant lox sites, respectively, and used to delete single genes and an entire operon. After transformation of the cells with a newly constructed cre expression plasmid (pRAB1), genomic eviction of the resistance genes was observed in approximately one out of ten candidates analyzed and subsequently verified by PCR. Due to its thermosensitive origin of replication, the plasmid was then easily eliminated at nonpermissive temperatures. We anticipate that the system presented here will prove useful for generating markerless deletion mutants in staphylococci.Staphylococci belong to the low-GϩC gram-positive bacteria, with a spherical morphology and characteristically form grape-like clusters. To date, at least 38 species of this genus have been identified (16, 46), which, although closely linked phylogenetically, differ markedly in their physiology. Staphylococcus carnosus is an apathogenic and, from a human viewpoint, rather beneficial bacterium, which has been used in the food industry since the 1950s. Among other processes, S. carnosus reduces nitrate to nitrite and eventually to ammonia in fermented meat, whereby both the nitrate concentration and the pH are lowered for preservation purposes (summarized in reference 16). The characteristic flavor of salami sausages is also conferred by S. carnosus. In addition, this species has proven suitable for expressing heterologous proteins (15), which can be secreted or displayed on the bacterial surface (37, 43) without risking endotoxin contamination. In contrast, the most prominent representative of staphylococci is S. aureus, reputedly the causative agent of various infections, such as mastitis, endocarditis, osteomyelitis, enterocolitis, and further illnesses that can be life-threatening in immunocompromised patients. A vast amount of nosocomial infections are attributed to S. aureus, some of which are increasingly hard to combat due to the strains' acquisition of multiple-antibiotic resistance (28). In particular, S. aureus strains resistant to methicillin or vancomycin can hardly be combated by the few remaining active antibiotics left (34). Although numerous pathogenicity factors have been identified and infection-related traits of S. aureus are increasingly better understood (summarized in reference 14), deeper insight into this organism's physiology is still necessary to identify potential sites of attack for novel ...

show abstract

Expression of Cre recombinase during transient phage infection permits efficient marker removal in Streptomyces

Cited by 35 publications

References 18 publications

The ROK Family Regulator Rok7B7 Pleiotropically Affects Xylose Utilization, Carbon Catabolite Repression, and Antibiotic Production in Streptomyces coelicolor

The ROK Family Regulator Rok7B7 Pleiotropically Affects Xylose Utilization, Carbon Catabolite Repression, and Antibiotic Production in Streptomyces coelicolor

Is PhoR–PhoP partner fidelity strict? PhoR is required for the activation of the pho regulon in Streptomyces coelicolor

Marker Removal in Staphylococci via Cre Recombinase and Different lox Sites

Contact Info

Product

Resources

About