Expression of FOXC2, PinX1, Ki-67 and Cyclin D1 in cutaneous cell carcinoma

Zhao, Haiying; Cao, Yun‐Feng; Wang, Guoqiang; Luo, Zengxiang

doi:10.3892/ol.2017.6244

Cited by 11 publications

(8 citation statements)

References 15 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…In addition, semi-quantitative RT-PCR was performed as previously described [ 17 ], using the following primers: FOXC2-2F CGCCCGAGAAGAAGATCAC; FOXC2-2R CGCTCTTGATCACCACCTTC; FOXC2-AS1-2F CTTGCCGGGCTTCTTGTCGT; FOXC2-AS1-2R TACATTTTCGTCTTCTGTTCTTTTATTGG. To exclude DNA contamination, FOXC2 expression analysis was carried out on samples with and without reverse transcriptase (+RT and −RT).…”

Section: Methodsmentioning

confidence: 99%

Imbalance between Expression of FOXC2 and Its lncRNA in Lymphedema-Distichiasis Caused by Frameshift Mutations

Missaglia

Tavian

Michelini

et al. 2021

Genes

View full text Add to dashboard Cite

Forkhead-box C2 (FOXC2) is a transcription factor involved in lymphatic system development. FOXC2 mutations cause Lymphedema-distichiasis syndrome (LD). Recently, a natural antisense was identified, called lncRNA FOXC2-AS1, which increases FOXC2 mRNA stability. No studies have evaluated FOXC2 and FOXC2-AS1 blood expression in LD and healthy subjects. Here, we show that FOXC2 and FOXC-AS1 expression levels were similar in both controls and patients, and a significantly higher amount of both RNAs was observed in females. A positive correlation between FOXC2 and FOXC2-AS1 expression was found in both controls and patients, excluding those with frameshift mutations. In these patients, the FOXC2-AS1/FOXC2 ratio was about 1:1, while it was higher in controls and patients carrying other types of mutations. The overexpression or silencing of FOXC2-AS1 determined a significant increase or reduction in FOXC2 wild-type and frameshift mutant proteins, respectively. Moreover, confocal and bioinformatic analysis revealed that these variations caused the formation of nuclear proteins aggregates also involving DNA. In conclusion, patients with frameshift mutations presented lower values of the FOXC2-AS1/FOXC2 ratio, due to a decrease in FOXC2-AS1 expression. The imbalance between FOXC2 mRNA and its lncRNA could represent a molecular mechanism to reduce the amount of FOXC2 misfolded proteins, protecting cells from damage.

show abstract

Section: Methodsmentioning

confidence: 99%

Imbalance between Expression of FOXC2 and Its lncRNA in Lymphedema-Distichiasis Caused by Frameshift Mutations

Missaglia

Tavian

Michelini

et al. 2021

Genes

View full text Add to dashboard Cite

show abstract

“…Staining score was defined as follows: score 0, ≤5%; score 1, 6–25%; score 2, 26–50%; score 3, 51–75% and score 4, >76% of cells were stained. The final immunoreactivity score was calculated as the sum of the grade and staining scores ( 36 ).…”

Section: Methodsmentioning

confidence: 99%

Regulatory effect between HMGA2 and the Wnt/β‑catenin signaling pathway in the carcinogenesis of sporadic colorectal tubular adenoma

Cao

Wang

et al. 2021

Oncol Lett

View full text Add to dashboard Cite

Due to the high incidence of colorectal cancer worldwide, the underlying molecular mechanisms have been extensively investigated. The Wnt/β-catenin signaling pathway plays a key role in the carcinogenesis of colorectal adenoma. In addition, the high mobility group AT-hook 2 (HMGA2) protein, which is involved in several biological processes, such as proliferation, differentiation, transformation and metastasis, is expressed at significantly high levels in colorectal cancer tissues compared with adjacent normal tissues. Currently, the role of HMGA2 in the carcinogenesis of sporadic colorectal tubular adenoma remains unclear. The downstream Wnt/β-catenin signaling molecule, T-cell factor/lymphoid enhancing factor (TCF/LEF), shares a similar domain with HMGA2, which enhances β-catenin transcriptional activity and TCF/LEF binding. Thus, the present study investigated the association between HMGA2 and the Wnt/β-catenin signaling pathway, and their role in the carcinogenesis of sporadic colorectal tubular adenoma via immunohistochemistry, siRNA, quantitative PCR and western blot analyses. The results demonstrated that the positive rate of HMGA2 expression gradually increased during tumor progression. Furthermore, HMGA2 expression was positively correlated with Wnt/β-catenin signaling protein expression [Wnt, β-catenin, cyclin-dependent kinase 4 (CDK4) and cyclin D1], suggesting its involvement in the carcinogenesis of sporadic colorectal tubular adenoma and its potential to synergistically interact with the Wnt/β-catenin signaling pathway. HMGA2 knockdown in the human colorectal cancer cell line, HCT 116 decreased β-catenin expression and its downstream targets, CDK4 and cyclin D1. Furthermore, silencing of Wnt or β-catenin decreased HMGA2 expression. Taken together, the results of the present study suggest the coordinated regulation of HMGA2 and the Wnt/β-catenin signaling pathway in the carcinogenesis of sporadic colorectal tubular adenoma.

show abstract

“…A number of investigations reported a considerable and at times significant decrease in the ki67 labeling index of BCC compared to SCC. 15 , 16 On the other hand, Abdou et al demonstrated an increased expression of MCM2 in BCC when compared to SCC. 17 …”

Section: Introductionmentioning

confidence: 99%

Cell kinetic markers in cutaneous squamous and basal cell carcinoma of the head and neck

Alaeddini¹,

Etemad‐Moghadam²

2022

Brazilian Journal of Otorhinolaryngology

View full text Add to dashboard Cite

Expression of FOXC2, PinX1, Ki-67 and Cyclin D1 in cutaneous cell carcinoma

Cited by 11 publications

References 15 publications

Imbalance between Expression of FOXC2 and Its lncRNA in Lymphedema-Distichiasis Caused by Frameshift Mutations

Imbalance between Expression of FOXC2 and Its lncRNA in Lymphedema-Distichiasis Caused by Frameshift Mutations

Regulatory effect between HMGA2 and the Wnt/β‑catenin signaling pathway in the carcinogenesis of sporadic colorectal tubular adenoma

Cell kinetic markers in cutaneous squamous and basal cell carcinoma of the head and neck

Contact Info

Product

Resources

About