Expression of Functional Chemokine Receptors of Human Placental Cells

Ishii, Maki; Suzuki, M.; Chishima, Fumihisa; Nagaishi, Masaji; Satoh, Kazuo; HAYAKAWA, SATOSHI; YOSHINO, NAOTO; Honda, Mitsuo; Nishinarita, Susumu

doi:10.1111/j.8755-8920.2000.440608.x

Cited by 38 publications

(26 citation statements)

References 16 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…28 CCR6 is essential for the migration of Th17 cells. 29,30 Human placental cells express a series of functional chemokines, 31 and we speculate that placental cells may attract peripheral Th17 cells into decidua. It has been demonstrated that DSCs other than trophoblasts recruit peripheral Th17 cell into decidua.…”

Section: Discussionmentioning

confidence: 88%

Decidual stromal cells recruit Th17 cells into decidua to promote proliferation and invasion of human trophoblast cells by secreting IL-17

Jin

et al. 2014

Cell Mol Immunol

View full text Add to dashboard Cite

T helper 17 (Th17) cells have both regulatory and protective roles in physiological conditions. The Th17 subset and the cytokine interleukin-17A (IL-17A) have been implicated in the pathogenesis of certain autoimmune diseases, several types of cancer and allograft rejection. However, the role of Th17 cells at the maternal/fetal interface remains unknown. Here, we demonstrate that Th17 cells are present in decidua and are increased in the peripheral blood of 10 clinically normal pregnancies based on intracellular cytokine analysis. Our results suggest a potential role of Th17 cells in sustaining pregnancy in humans. Furthermore, we demonstrate that decidual stromal cells (DSCs) but not trophoblast cells recruit peripheral Th17 cells into the decidua by secreting CCL2. The recruited Th17 cells promote proliferation and invasion and inhibit the apoptosis of human trophoblast cells by secreting IL-17 during the first trimester of pregnancy. These findings indicate a novel role for Th17 cells in controlling the maternal-fetal relationship and placenta development.

show abstract

Section: Discussionmentioning

confidence: 88%

Decidual stromal cells recruit Th17 cells into decidua to promote proliferation and invasion of human trophoblast cells by secreting IL-17

Jin

et al. 2014

Cell Mol Immunol

View full text Add to dashboard Cite

show abstract

“…Interestingly, mRNA for these chemokines was expressed predominantly in the decidual samples and almost undetectable in their chorionic counterparts. Using RT-PCR, Ishii et al demonstrated mRNAs for RANTES, MIP-1α and MCP-3 in chorionic samples from the first trimester (Ishii et al, 2000). This apparent discrepancy might be due to differences in PCR conditions.…”

Section: Discussionmentioning

confidence: 99%

“…Placental tissues (6-9 weeks of gestation, n=15) CCR1 595 CTCTTCCTGTTCACGCTTCC CCAAATGTCTGCTCTGCTCA NM_001295 CCR2 600 AACTCCTGCCTCCGCTCTAC TCACTGCCCTATGCCTCTTC XM_002924 CCR3 588 TCTTCCTCGTCACCCTTCCA GCTTCGTCCGCTCACAGTCA AB023887 CCR4 608 CTTCCTGCCCCCACTGTATT TCTTCACCGCCTTGTTCTTC NM_005508 CCR5 818 TCCTGCCTCCGCTCTACT GAACTTCTCCCCGACAAA XM_002925 CCR6 609 AATCATCTGCCTTGTTGTGT TTGTCGTTATCTGCGGTCTC NM_004367 CCR7 581 TGGCTCTCCTTGTCATTTTC TTGCTCACTGCTGCTCCTCT NM_001838 CCR8* 286 AGTATGCACATCTTGGATGG TGTAGTCTACGCTGGAGGAA U45983 CCR9 580 CCAAGCACAAAGCCCTAAAA CAGTCAAGAGCCAATCAACA AF145440 CCR10* 493 GGGTTTCTCCTTCCACTCCT TATTCCCCACATCCTCCTTG U94888 CCR11 450 *Primer pairs were taken from published articles (Kojima et al, 1994;Jordan et al, 1999;Ishii et al, 2000;Middel et al, 2001;Huber et al, 2002;Kawaguchi et al, 2002). were washed with sterile RPMI and dissected aseptically to remove decidual tissues and fetal membrane. Small fragments of chorionic villi (∼2 mm in diameter) were teased apart and soaked in culture medium [RPMI containing 10% FCS (Gibco), 100 U ml −1 penicillin and 100 µg ml −1 streptomycin (Gibco)].…”

Section: Human Chorionic Villous Explant Culture and Isolation Of Evtsmentioning

confidence: 99%

“…In some experiments, reverse transcriptase was omitted as a control for the amplification of contaminating genomic DNA. PCR was performed in 20 µl of Taq buffer (+Mg 2+ ), containing 1 µl of the indicated cDNA solution, 2 mM dNTPs and 0.5 U of rTaq DNA polymerase (Toyobo, Osaka, Japan) with 0.5 mM each of sense and antisense primers for chemokines, chemokine receptors and S26 as a housekeeping probe (Table 1) (Kojima et al, 1994;Jordan et al, 1999;Ishii et al, 2000;Middel et al, 2001;Huber et al, 2002;Kawaguchi et al, 2002). The conditions for amplification were: 5 minutes at 94°C, 30 cycles of 1 minute at 94°C, annealing for 1 minute at 56-64°C and incubation for 1 minute at 75°C, followed by a final extension for 5 minutes at 75°C.…”

Section: Rt-pcr Analysismentioning

confidence: 99%

“…They are considered to be involved in either recruiting specific leukocyte populations to the feto-maternal interface or modulating trophoblastic function (Ishii et al, 2000). The latter function is supported by the fact that human choriocarcinoma cell lines as well as human placental syncytiotrophoblast express functional chemokine receptors (Ishii et al, 2000;Douglas et al, 2001). To date, however, no chemokine receptor has been demonstrated on migrating trophoblasts (i.e.…”

Section: Introductionmentioning

confidence: 99%

See 2 more Smart Citations

Trophoblasts acquire a chemokine receptor, CCR1, as they differentiate towards invasive phenotype

et al. 2003

View full text Add to dashboard Cite

At the human feto-maternal interface, trophoblasts differentiate towards extravillous trophoblasts (EVTs) and form the cell column. EVTs acquire invasive activity in the distal part of the cell column and begin to migrate into the maternal tissue. We previously reported that dipeptidyl peptidase IV(DPPIV) is expressed on EVTs in the proximal part of cell column and is involved in the inhibition of their migration. Because DPPIV has been shown to degrade several chemokines, we examined possible roles of chemokines in EVT migration.Immunohistochemistry demonstrated that C-C chemokine receptor 1 (CCR1) was hardly detected on cytotrophoblasts and syncytiotrophoblast but was expressed on EVTs in the cell column. In vitro, CCR1 protein was also present on the surface of EVTs that grew out from chorionic villous explants cultured under 20% O2. Chemokines that can bind to CCR1 (CCR1 ligands), such as regulated on activation, normal T cell expressed and secreted (RANTES) and macrophage inflammatory protein-1α (MIP-1α), were confirmed in the decidual tissues by RT-PCR and immunohistochemistry. These CCR1 ligands promoted the migration of the EVTs that were isolated from the explant cultures in vitro. These results indicate that CCR1 is expressed on trophoblasts as they differentiate to EVTs and that CCR1 ligands produced from the decidual tissue induce EVT migration.By contrast, CCR1 was scarcely expressed on EVTs that grew out from villous explants cultured in 1% O2, indicating that a relatively high oxygenic environment is needed to induce CCR1 expression. Moreover, CCR1 expression on the isolated EVTs was significantly reduced in the presence of decidua-conditioned medium. Such regulation of CCR1 by surrounding oxygenic and decidual environments supports a close correlation between EVT invasion and their expression of CCR1.This study demonstrates that trophoblasts acquire CCR1 as they differentiate to an invasive phenotype at the villus-anchoring sites and indicates a novel role for the chemokine-CCR1 system in the initial step of trophoblastic invasion towards the maternal tissue.

show abstract

Biological mechanisms of vertical human immunodeficiency virus (HIV‐1) transmission

Lehman

Farquhar

2007

Reviews in Medical Virology

View full text Add to dashboard Cite

In the absence of interventions, 30-45% of exposed infants acquire human immunodeficiency virus type 1 (HIV-1) through mother-to-child transmission. It remains unclear why some infants become infected while others do not, despite significant exposure to HIV-1 in utero, during delivery and while breastfeeding. Here we discuss the correlates of vertical transmission with an emphasis on factors that increase maternal HIV-1 levels, either systemically or locally in genital secretions and breast milk. Immune responses may influence maternal viral load, and data suggest that maternal neutralising antibodies reduce infection rates. In addition, infants may be capable of mounting HIV-specific cellular immune responses. We propose that both humoral and cellular responses are necessary to reduce infection because cell-free as well as cell-associated virus appears to play a role in vertical transmission. These distinct forms of the virus may be targeted most effectively by different components of the immune system. We also discuss the use of antiretrovirals to reduce transmission, focusing on the mechanisms of action of regimens currently used in developing country settings. We conclude that prevention relies not only on reducing maternal HIV-1 levels within blood, genital tract and breast milk, but also on pre- and/or post-exposure prophylaxis to the infant. However, HIV-1 has the capacity to mutate under drug pressure and rapidly acquires mutations conferring antiretroviral resistance. This review concludes with data on persistence of low-level resistance after delivery as well as recent guidelines for maternal and infant regimens designed to limit resistance.

show abstract

Expression of Functional Chemokine Receptors of Human Placental Cells

Abstract: Our results suggest possible roles of chemokines/chemokine receptors on placental physiology and their involvement in HIV transmission as alternative receptors.

Cited by 38 publications

References 16 publications

Decidual stromal cells recruit Th17 cells into decidua to promote proliferation and invasion of human trophoblast cells by secreting IL-17

Decidual stromal cells recruit Th17 cells into decidua to promote proliferation and invasion of human trophoblast cells by secreting IL-17

Trophoblasts acquire a chemokine receptor, CCR1, as they differentiate towards invasive phenotype

Biological mechanisms of vertical human immunodeficiency virus (HIV‐1) transmission

Contact Info

Product

Resources

About