Expression of genes encoding cellulolytic enzymes in some Aspergillus species

Abstract

ABSTRACT. Fermentation is an important industrial process for microbial metabolite development and has wide applications in various fields. Aspergillus is the most important genus of fungi used for the production of microbial enzymes such as cellulase. The Aspergillus genome encodes various cellulolytic enzymes. In this study, we assayed the gene expression and cellulolytic enzyme production of three isolates: A. niger (KSU009), A. terreus (KC462061), and A. flavus (KSU014). Two fermentation systems, submerged fermentation and biofilm fermentation (BF), were used for this purpose. Gene expression analysis by RT-PCR showed that cbhB, exo, eglA, eglB, eglC, and β-actin genes were differentially expressed in the two fermentation systems for these three isolates during enzyme production. Furthermore, the expression of all genes was found to be higher in the BF system. The six genes were not expressed in the isolates with no cellulolytic enzyme production. The isolates were identified by morphological and molecular methods, which were based on macroscopic characteristics and sequence analysis of ITS1, ITS2, and the 5.8S regions of rDNA.

A comparative genomics study of 23 Aspergillus species from section Flavi

“…Carbohydrate-Active enZymes (CAZymes) are essential for what carbon sources a species can degrade and utilize. Within section Flavi the CAZymes/carbon utilization is mainly described for A. oryzae 1,2,40 and to a lesser extent for A. flavus [41][42][43][44][45] and A. sojae 46,47 , while only incidental studies have been performed with other species of this group [48][49][50][51][52][53][54] , often describing production or characterization of a certain CAZyme activity or protein, respectively.…”

Identification of Endoglucanase Gene Responsible for Cellulose Degradation Using Aspergillus flavus

“…PCRamplified with the universal primers for ITS region using ITS5 (TCCTCCGCTTATTGATATGC), ITS4 (GGAAGTAAAAGTCGTAACAAGG) and 18S rRNA using NS1 (18S) (GTAGTCATATGCTTGTCTC) and NS4 (18S) (CTTCCGTCAATTCCTTTAAG). For partial sequence of the endoglucanase gene (egl B), primers eglB-F (5' ATCTCAACCAAGCAGCCATT-3') and eglB-R (5' CCAGGATATCCAGCATACCC-3') were used (Mahmoud et al, 2016). PCR was performed using the standard reaction mixture (50 µl) containing; 1× PCR buffer, 1.5 mM MgCl 2 , 200 mM of each dNTPs, 15 pmol of each primer, 1 U of Taq polymerase enzyme (Promega®Corporation, Madison, USA) and 50 ng of DNA template.…”

“…Endoglucanse gene of the fungal isolate S4 was amplified using specific primers (Mahmoud et al, 2016). For Aspergillus sp., eglB gene was amplified with 356 bp (Figure, 7); the sequence of the amplified gene was submitted to the GenBank under accession number LC385522.1.…”