Expression of homeobox genes in the mouse olfactory epithelium

Abstract

Homeobox genes constitute a large family of genes widely studied because of their role in the establishment of the body pattern. However, they are also involved in many other events during development and adulthood. The main olfactory epithelium (MOE) is an excellent model to study neurogenesis in the adult nervous system. Analyses of homeobox genes during development show that some of these genes are involved in the formation and establishment of cell diversity in the MOE. Moreover, the mechanisms of expression of odorant receptors (ORs) constitute one of the biggest enigmas in the field. Analyses of OR promoters revealed the presence of homeodomain binding sites in their sequences. Here we characterize the expression patterns of a set of 49 homeobox genes in the MOE with in situ hybridization. We found that seven of them (Dlx3, Dlx5, Dlx6, Msx1, Meis1, Isl1, and Pitx1) are zonally expressed. The homeobox gene Emx1 is expressed in three guanylate cyclase(+) populations, two located in the MOE and the third one in an olfactory subsystem known as Grüneberg ganglion located at the entrance of the nasal cavity. The homeobox gene Tshz1 is expressed in a unique patchy pattern across the MOE. Our findings provide new insights to guide functional studies that aim to understand the complexity of transcription factor expression and gene regulation in the MOE. J. Comp. Neurol. 524:2713-2739, 2016. © 2016 Wiley Periodicals, Inc.

Meis1 effects on motor phenotypes and the sensorimotor system in mice

“…This indicates that alternative processes likely mediate the enhanced social memory consequent to Meis1 deficiency. Recent evidence showing zonal Meis1 expression in the main olfactory epithelium could signify one potential avenue for further investigation in this regard ( Parrilla et al, 2016 ). Furthermore, in light of this new evidence, a more detailed analysis of cognitive ability in RLS patients with the MEIS1 risk haplotype is warranted.…”

Disruption of the Microglial ADP Receptor P2Y13 Enhances Adult Hippocampal Neurogenesis

“…The riboprobes applied for P2ry13 were F: ACAGACAACATCACCCTAGCCT, R: CCT CTCTTCTGGTGCTCTGTTT (corresponding to nucleotide positions 1055-1663 [accession number NM_028808.3, available from Allen Bain Atlas] 1 and for Cx3cr1 F: GACGATT CTGCTGAGGCCTGTTA, R: CCTCGCTTGTGTAGTGAGTG AAAC (corresponding to nucleotide position 147-1143) [accession number NM_028808.3]). Riboprobes were designed and synthesized as previously described (Ishii et al, 2004 ; Parrilla et al, 2016 ) using hippocampus cDNA as a template. Single- or two-color FISH combined with immunohistochemistry was performed as described (Ishii et al, 2004 ) with slight modifications: (1) hybridization step: slices were incubated in 12 μg/ml of proteinase K solution at 37°C for 16 min; (2) hybridization of P2ry13 and Cx3cr1 riboprobes labeled with digoxigenin and fluorescein, respectively, was performed at 65°C overnight in the hybridization solution (Parrilla et al, 2016 ); and (3) detection step: antibodies against digoxigenin-alkaline phosphatase (11093274910, Roche) and fluorescein horseradish peroxidase (NEF710, PerkinElmer) were incubated together with the following primary antibodies: anti-Iba1, anti-GFAP, anti-SRY (sex determining region Y)-box 2 (Sox2; Sc-17320, 1:200, Santa Cruz), anti-DCX, anti-NeuN (ABN78, 1:500, Millipore), anti-somatostatin (AB5494, 1:200, Millipore) and/or anti-parvalbumin (PV27, 1:200, Swant).…”

“…Single- or two-color FISH combined with immunohistochemistry was performed as described (Ishii et al, 2004 ) with slight modifications: (1) hybridization step: slices were incubated in 12 μg/ml of proteinase K solution at 37°C for 16 min; (2) hybridization of P2ry13 and Cx3cr1 riboprobes labeled with digoxigenin and fluorescein, respectively, was performed at 65°C overnight in the hybridization solution (Parrilla et al, 2016 ); and (3) detection step: antibodies against digoxigenin-alkaline phosphatase (11093274910, Roche) and fluorescein horseradish peroxidase (NEF710, PerkinElmer) were incubated together with the following primary antibodies: anti-Iba1, anti-GFAP, anti-SRY (sex determining region Y)-box 2 (Sox2; Sc-17320, 1:200, Santa Cruz), anti-DCX, anti-NeuN (ABN78, 1:500, Millipore), anti-somatostatin (AB5494, 1:200, Millipore) and/or anti-parvalbumin (PV27, 1:200, Swant). Signals of digoxigenin and fluorescein probes were detected as described (Parrilla et al, 2016 ). Primary antibodies were detected with Alexa Fluor 488-coupled donkey anti-mouse (A21202, 1:500), donkey anti-rat (A21208, 1:500) or Alexa Fluor 647-coupled donkey anti-rabbit (A31573, 1:250) or donkey anti-goat (A21447, 1:250) secondary antibodies (all from Life Technologies).…”

Prep1 Deficiency Affects Olfactory Perception and Feeding Behavior by Impairing BDNF-TrkB Mediated Neurotrophic Signaling

“…Previous studies demonstrated that many Prep1 co-factors, belonging to TALE family, are highly abundant in mouse olfactory bulbs and play key roles in olfactory interneurons’ regeneration from SVZ neuroblasts [ 21 , 22 ]. Therefore, the marked expression of Prep1 in olfactory bulb might suggest a key biological function of this transcription factor in olfactory sensory circuit or olfactory renewal processes, which are inevitably related.…”

“…However, Prep1 plays also a central function in the early and late stages of rodent brain development, by forming binary and ternary complexes with other homeodomain factors, such as Pbx1, Hoxb1, and Meis [ 15 – 19 ]. Stable expression and activity of these Prep1 co-factors, however, have been detected also in many regions of adult brain, especially in olfactory sensory areas [ 20 – 22 ]. In silico gene expression data, reported on Bio-GPS® ( http://biogps.org/#goto=genereport&id=18771 ) and Allen Brain® ( http://mouse.brain-map.org/gene/show/18535 ) web-based atlases, show that Prep1 is widely expressed in several regions of adult mouse brain but in particular within the olfactory bulb.…”