Expression of interleukin-17B in mouse embryonic limb buds and regulation by BMP-7 and bFGF

You, Zongbing; DuRaine, Grayson; Tien, Janet; Lee, Corinne; Moseley, Timothy A.; Reddi, A. Hari

doi:10.1016/j.bbrc.2004.11.087

Cited by 23 publications

(16 citation statements)

References 31 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…An additional role of IL-17B in tamoxifen recurrence may involve cross-talk between IL-17B and the extracellular signal-regulated kinase pathway. You et al showed IL-17B expression in mouse embryonic limb buds, and downregulation of IL-17B by fibroblast growth factor via the extracellular signal-regulated kinase pathway (31). Therefore, IL-17 BR may play a role in tamoxifen recurrence either through the induction of antitumor immunity, or in mediating the response to growth factors involved in breast epithelial tumor proliferation.…”

Section: Discussionmentioning

confidence: 99%

A Two-Gene Expression Ratio of Homeobox 13 and Interleukin-17B Receptor for Prediction of Recurrence and Survival in Women Receiving Adjuvant Tamoxifen

Goetz¹,

Suman

Ingle³

et al. 2006

Clinical Cancer Research

149

View full text Add to dashboard Cite

Purpose: In the adjuvant treatment of estrogen receptor (ER)^positive breast cancer, additional markers are needed to identify women at high risk for recurrence. Experimental Design: We examined the association between the ratio of the homeobox 13 (HOXB13) to interleukin-17B receptor (IL-17BR) expression and the clinical outcomes of relapse and survival in women with ER-positive breast cancer enrolled onto a North Central Cancer Treatment Group adjuvant tamoxifen trial . Results: Tumor blocks were obtained from 211of 256 eligible patients, and quantitative reverse transcription-PCR profiles for HOXB13 and IL-17BR were obtained from 206 patients. The cut point for the two-gene log 2(expression ratio) that best discriminated clinical outcome (recurrence and survival) was selected and identified women with significantly worse relapse-free survival (RFS), disease-free survival (DFS), and overall survival (OS), independent of standard prognostic markers. The cut point differed as a function of nodal status [node negative (59th percentile) versus node positive (90th percentile)]. In the node-positive cohort (n = 86), the HOXB13/IL-17BR ratio was not associated with relapse or survival. In contrast, in the nodenegative cohort (n = 130), a high HOXB13/IL-17BR ratio was associated with significantly worse RFS [hazard ratio (HR), 1.98; P = 0.031], DFS (HR, 2.03; P = 0.015), and OS (HR, 2.4; P = 0.014), independent of standard prognostic markers. Conclusion: A high HOXB13/IL-17BR expression ratio is associated with increased relapse and death in patients with resected node-negative, ER-positive breast cancer treated with tamoxifen and may identify patients in whom alternative therapies should be studied.In the adjuvant treatment of estrogen receptor (ER) -positive breast cancer, hormonal therapy reduces the risk of breast cancer recurrence and decreases mortality. Tamoxifen, one of the most commonly used medications in the adjuvant treatment of ERpositive breast cancer, is a selective ER modulator that competes with estrogen for binding to the ER. When administered to women with surgically treated ER-positive breast cancer, tamoxifen reduces the risk of recurrence and death when taken for 5 years (1).The ER and progesterone receptor are the most important tumor markers that predict response to tamoxifen (2). However, because a significant proportion of ER-positive breast cancers fail to respond or eventually develop resistance to tamoxifen, additional prognostic markers, including tumor size, tumor grade, and nodal status, are commonly used by physicians to make treatment decisions. Clinical studies have shown, however, that even in ''good-prognosis'' tumors (e.g., estrogen positive, lymph node negative), up to 20% of women will experience recurrence despite 5 years of adjuvant tamoxifen therapy (3, 4). These findings indicate the need for additional markers that will identify women at high risk for recurrence.Recent studies have shown that the gene expression signature of a tumor is a means to predict recurrence ...

show abstract

Section: Discussionmentioning

confidence: 99%

A Two-Gene Expression Ratio of Homeobox 13 and Interleukin-17B Receptor for Prediction of Recurrence and Survival in Women Receiving Adjuvant Tamoxifen

Goetz¹,

Suman

Ingle³

et al. 2006

Clinical Cancer Research

149

View full text Add to dashboard Cite

show abstract

“…Cell lysates from 293 cells overexpressing IL-17RL or IL-17Rh1 were prepared in radioimmunoprecipitation assay (RIPA) lysis buffer. Coimmunoprecipitation of IL-17F with IL-17RL was done essentially as described (27), except that anti-IL-17F antibodies were used for immunoprecipitation and anti-V5 antibodies were used for Western blot. Pull-down assay was done by incubating the Fc-tagged IL-17 cytokines with the cell lysates and protein G-Sepharose beads.…”

Section: Introductionmentioning

confidence: 99%

“…The collection of the human bone metastatic prostate tumor tissues was approved by University of California Davis Institutional Review Board (29). Immunohistochemical staining of IL-17RL was done on paraffin-embedded human tumor tissue sections as described (27), using rabbit anti-IL17RL antibodies.…”

Section: Introductionmentioning

confidence: 99%

See 1 more Smart Citation

Interleukin-17 Receptor-Like Gene Is a Novel Antiapoptotic Gene Highly Expressed in Androgen-Independent Prostate Cancer

You

Shi²,

DuRaine

et al. 2006

Cancer Research

Self Cite

View full text Add to dashboard Cite

We have recently identified a new gene, interleukin-17 receptor-like (IL-17RL), which is expressed in normal prostate and prostate cancer. This investigation is focused on the role of IL-17RL in prostate cancer. We found that IL-17RL was expressed at significantly higher levels in several androgenindependent prostate cancer cell lines (PC3, DU145, cds1, cds2, and cds3) and tumors compared with the androgendependent cell lines (LNCaP and MLC-SV40) and tumors. In an in vivo model of human prostate tumor growth in nude mice (CWR22 xenograft model), IL-17RL expression in tumors was induced by androgen deprivation. The relapsed androgenindependent tumors expressed higher levels of IL-17RL compared with the androgen-dependent tumors. Overexpression of IL-17RL in tumor necrosis factor A (TNFA)-sensitive LNCaP cells inhibited TNFA-induced apoptosis by blocking activation of caspase-3 downstream to caspase-2 and caspase-8. Reciprocally, knocking down IL-17RL expression by small interfering RNA induced apoptosis in all the prostate cancer cell lines studied. Taken together, these results show that IL-17RL is a novel antiapoptotic gene, which may confer partially the property of androgen-independent growth of prostate cancer by promoting cell survival. Thus, IL-17RL is a potential therapeutic target in the treatment of prostate cancer. (Cancer Res 2006; 66(1): 175-83)

show abstract

“…The viscera, including the heart and the body wall covering it, were dissected as negative controls. The previous protocols were used (You et al, 2005). Mouse Dcx primers were: forward, 5 0 GAGCAGGTCCTGACTGACATCA 3 0 ; reverse, 5 0 AACAC ATCATCATCACCAAAGAAATC 3 0 .…”

Section: Rna Isolation and Real-time Quantitative Pcrmentioning

confidence: 99%

Expression of doublecortin reveals articular chondrocyte lineage in mouse embryonic limbs

Zhang

Cigáň

Marrero

et al. 2011

Genesis

Self Cite

View full text Add to dashboard Cite

The doublecortin (Dcx) gene encodes a microtubule-binding protein that was originally found in immature neurons. In this study, we used two mouse strains that express reporter genes (LacZ and enhanced green fluorescence protein, respectively) driven by the endogenous Dcx promoter. We found that Dcx was expressed in the mesenchymal cells in the mouse embryonic limb buds. A population of the mesenchymal cells continued Dcx expression after they differentiated into joint interzone cells and then articular chondrocytes. In contrast, the endochondral chondrocytes lost Dcx expression when the mesenchymal cells differentiated into endochondral chondrocytes. These data support a concept that the articular and endochondral chondrocytes originate from the same mesenchymal cells that express Dcx. In contrast to the notion that articular chondrocytes are derived from de-differentiated endochondral chondrocytes, our findings demonstrate that the lineages of articular and endochondral chondrocytes bifurcate at the stage of endochondral chondrogenesis.

show abstract

Expression of interleukin-17B in mouse embryonic limb buds and regulation by BMP-7 and bFGF

Cited by 23 publications

References 31 publications

A Two-Gene Expression Ratio of Homeobox 13 and Interleukin-17B Receptor for Prediction of Recurrence and Survival in Women Receiving Adjuvant Tamoxifen

A Two-Gene Expression Ratio of Homeobox 13 and Interleukin-17B Receptor for Prediction of Recurrence and Survival in Women Receiving Adjuvant Tamoxifen

Interleukin-17 Receptor-Like Gene Is a Novel Antiapoptotic Gene Highly Expressed in Androgen-Independent Prostate Cancer

Expression of doublecortin reveals articular chondrocyte lineage in mouse embryonic limbs

Contact Info

Product

Resources

About